Прогнозирование эффективности таргетной терапии на основании биологических характеристик хронического миелолейкоза

Save this PDF as:
 WORD  PNG  TXT  JPG

Размер: px
Начинать показ со страницы:

Download "Прогнозирование эффективности таргетной терапии на основании биологических характеристик хронического миелолейкоза"

Транскрипт

1 Федеральное государственное бюджетное учреждение «Российский научно-исследовательский институт гематологии и трансфузиологии Федерального медико-биологического агентства» На правах рукописи Фоминых Михаил Сергеевич Прогнозирование эффективности таргетной терапии на основании биологических характеристик хронического миелолейкоза Гематология и переливание крови Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: Доктор медицинских наук, профессор Абдулкадыров Кудрат Мугутдинович Доктор биологических наук Мартынкевич Ирина Степановна Санкт-Петербург 2016

2 2 Оглавление Введение...4 Глава 1. Обзор литературы. Современные взгляды на принципы прогнозирования эффективности таргетной терапии и механизмы развития резистентности у больных хроническим миелолейкозом Определение, этиология, распространенность, патогенез и стадии хронического миелолейкоза Современные подходы к терапии хронического миелолейкоза Определение групп риска и критерии оценки ответа на проводимую терапию Клиническая значимость мутаций киназного домена гена BCR-ABL Клиническое значение дополнительных хромосомных аберраций Влияние сочетанного обнаружения дополнительных хромосомных аномалий и мутаций гена BCR-ABL Индивидуализация терапии ингибиторами тирозинкиназ у больных хроническим миелолейкозом...31 Глава 2. Методы исследования и характеристика пациентов Дизайн исследования Характеристика исследуемой группы пациентов Методы исследования Клинические и инструментальные методы Метод цитогенетического анализа Метод флуоресцентной на стекле гибридизации (FISH) Метод качественного определения химерного гена BCR-ABL Метод количественного определения экспрессии гена BCR-ABL Метод анализа мутационного статуса гена BCR-ABL Статистическая обработка данных...54 Глава 3. Результаты исследований Оценка влияния динамики уровня экспрессии гена BCR-ABL на результаты терапии...55

3 Определение прогностической способности динамики уровня экспрессии гена BCR-ABL Оценка влияния динамики уровня экспрессии гена BCR-ABL в течение первых трех месяцев терапии для достижения большого молекулярного ответа на 12 месяцев терапии в обучающей выборке Оценка влияния динамики уровня экспрессии гена BCR-ABL и частота достижения оптимального ответа в контрольной группе Исследование значения дополнительных хромосомных аберраций и мутаций киназного домена гена BCR-ABL для выживаемости больных хроническим миелолейкозом Анализ влияния дополнительных хромосомных аномалий на выживаемость Исследование значения точечных мутаций гена BCR-ABL Сочетание дополнительных хромосомных аберраций в Phположительных клетках и мутаций гена BCR-ABL Программа прогнозирования эффективности таргетной терапии больных хроническим миелолейозом...81 Обсуждение...82 Выводы...91 Практические рекомендации...92 Список сокращений и условных обозначений...94 Список литературы...95

4 4 Введение Актуальность исследования Достижения в понимании молекулярно-биологических особенностей развития хронического миелоидного лейкоза (ХМЛ), внедрение терапии ингибиторами тирозинкиназ (ИТК), системы контроля эффективности терапии, молекулярный анализ механизмов резистентности явились основой для разработки современных принципов лечения онкогематологических заболеваний. Применение первого ингибитора тирозинкиназ иматиниба в клинической практике в течение последнего десятилетия позволило кардинально повысить выживаемость больных ХМЛ. Общая 8-летняя выживаемость у больных хронической фазой (ХФ) ХМЛ составляет 85%, выживаемость без прогрессирования до фазы акселерации (ФА) и бластного криза (БК) 92%, что было недоступно при использовании предшествующих методов лечения [45]. Частота прогрессирования болезни при длительной 5-8 летней терапии иматинибом не превышает 0,5%. Общая 5-летняя выживаемость больных, достигших раннего молекулярного ответа (BCR-ABL IS 10% ) к 3 месяцам терапии, составляет 95% [63]. Однако, только около половины больных ХМЛ при терапии иматинибом достигают оптимальных ответов на лечение и подвержены минимальному риску развития рецидива и смерти, связанной с прогрессированием заболевания. Резистентность к проводимой терапии ИТК развивается на различных этапах лечения. Основой развития резистентности могут быть как несоблюдение протокола терапии и необоснованные перерывы в лечении, так и биологически обусловленные механизмы (BCR-ABL-зависимые или независимые), требующие дополнительного пристального внимания [12]. Вклад некоторых из них до сих пор является не до конца изученным, а полученные данные, в ряде случаев, противоречивыми. Больные с резистентностью к иматинибу требуют своевременного переключения на терапию ИТК второго поколения (ИТК2), а в некоторых случаях проведения аллогенной трансплантации гемопоэтических

5 5 стволовых кроветворных клеток (аллотгск), сопряженной с ограничениями по возрасту, значимыми рисками летальности и инвалидизации [140]. Основными причинами резистентности ХМЛ к терапии таргетными препаратами являются: точечные мутации киназного домена гена BCR-ABL, которые приводят к конформационным изменениям BCR-ABL-тирозинкиназы и неэффективности ИТК; обнаружение дополнительных хромосомных аберраций (ДХА). О роли мутаций и ДХА в развитии резистентности за последние годы накоплено довольно много данных, но частота, спектр и их прогностическое значение остаются малоизученными. Известно, что развитие точечных мутаций гена BCR-ABL ассоциировано с высокой вероятностью прогрессии заболевания и меньшей выживаемостью больных [3]. Обнаружение ДХА также связано с прогрессией ХМЛ в фазу акселерации и бластного криза [5, 36, 37]. В большинстве имеющихся рекомендаций наличие ДХА на момент диагностики расценивается как предупреждение, в то время как появление ДХА в ходе лечения рассматривается как неудача терапии. Вместе с этим, частота и клиническое значение сочетания ДХА и точечных мутаций BCR-ABL в настоящее время изучены недостаточно [90, 105, 150]. Существующие прогностические шкалы определения групп риска учитывают фазу заболевания на момент диагностики и не оценивают скорость элиминации опухолевого клона и переносимость проводимой терапии [65, 66, 143]. У части больных низкой группы риска оптимальный ответ не достигается по разным причинам: неудовлетворительная переносимость лечения (токсичность), резистентность, низкая приверженность к терапии. Гематологическая и негематологическая токсичность, которая развивается в ходе терапии, очень часто приводит к временной отмене ИТК, что в свою очередь снижает эффективность лечения. Именно поэтому большое количество исследований в последние годы направлены на разработку персонализированной терапии ХМЛ, основанной на

6 6 индивидуальных характеристиках опухоли [25, 64]. Таким образом, исследование биологических причин резистентности, динамики индивидуального ответа на терапию, для раннего предотвращения прогрессирования заболевания в продвинутые фазы и достижения оптимального результата лечения у пациентов с ХМЛ остается актуальной проблемой. Степень разработанности темы Накоплено большое количество данных, свидетельствующих о негативном влиянии ДХА и мутаций киназного домена гена BCR-ABL на частоту прогрессирования и выживаемость у больных с ХМЛ. Тем не менее, существующая классификация ДХА основана только на частоте их встречаемости. Имеющиеся результаты влияния «значимых» и комплексных ДХА в Ph-положительных клетках противоречивы. Значение обнаруженных мутаций киназного домена гена BCR-ABL хорошо изучено у больных ХМЛ с резистентностью к терапии иматинибом. Данные по значимости мутаций у больных ХМЛ, получающих терапию ИТК2, ограничены достижением цитогенетических или молекулярных ответов. Также, в литературе отсутствуют сведения о прогностическом значении сочетанного обнаружения ДХА и точечных мутаций гена BCR-ABL. Общепринятые прогностические шкалы и суррогатные маркеры раннего ответа на лечение для определения эффективности терапии не учитывают индивидуальную скорость элиминации опухолевого клона и переносимость проводимой терапии. Цель исследования Разработать программу прогнозирования эффективности таргетной терапии больных хроническим миелолейкозом на основе анализа динамики уровня экспрессии гена BCR-ABL, дополнительных хромосомных аберрации и точечных мутаций гена BCR-ABL.

7 7 Задачи исследования 1. Оценить возможность прогнозирования эффективности таргетной терапии больных хроническим миелолейкозом на основании динамики уровня экспрессии гена BCR-ABL в течение первых трех месяцев лечения. 2. Определить частоту обнаружения дополнительных хромосомных аберраций в Ph-положительных клетках и их влияние на общую выживаемость и летальность, связанную с прогрессией хронического миелолейкоза. 3. Выявить взаимосвязь мутаций киназного домена гена BCR-ABL с общей выживаемостью и частотой летальных исходов, обусловленных прогрессированием у больных хроническим миелолейкозом. 4. Проанализировать общую выживаемость и летальность, связанную с прогрессированием хронического миелолейкоза при сочетанном выявлении дополнительных хромосомных аберраций и мутаций гена BCR-ABL. 5. Разработать программу прогнозирования эффективности таргетной терапии больных хроническим миелолейкозом, основанную на оценке индивидуальных биологических характеристик опухоли. Научная новизна исследования По результатам исследования впервые продемонстрирована целесообразность использования динамики уровня экспрессии гена BCR-ABL в течение первых трех месяцев лечения для прогнозирования эффективности терапии больных хроническим миелолейкозом. Получены новые данные о взаимосвязи комплексных дополнительных хромосомных аномалий в Ph-положительном клоне, а также сочетания дополнительных хромосомных аберраций и мутаций в киназном домене гена BCR-ABL с уменьшением общей выживаемости и увеличением частоты летальных

8 8 исходов, связанных с прогрессией заболевания у пациентов с хроническим миелолейкозом. Установлена ассоциация между обнаружением точечных мутаций гена BCR- ABL и увеличением рисков прогрессирования заболевания и летальных исходов по причине прогрессии хронического миелолейкоза. Впервые разработана программа прогнозирования эффективности таргетной терапии у больных хроническим миелолейкозом на основании биологических характеристик опухоли. Практическая значимость работы Разработан способ прогнозирования эффективности терапии у больных хроническим миелолейкозом с использованием методики определения динамики уровня экспрессии гена BCR-ABL. Установлена необходимость сочетанного цитогенетического и молекулярно-генетического мониторинга терапии хронического миелолейкоза для выявления комплексных дополнительных хромосомных аберраций в Ph-положительных клетках и мутаций гена BCR-ABL. Доказано негативное влияние сочетания дополнительных хромосомных аномалий в Ph-положительных клетках и мутаций киназного домена гена BCR-ABL на общую выживаемость и летальность, связанную с прогрессированием хронического миелолейкоза. Предложена и обоснована программа прогнозирования эффективности таргетной терапии больных хроническим миелолейкозом, основанная на оценке индивидуальных биологических характеристик опухоли. Основные положения, выносимые на защиту 1. Динамика уровня экспрессии гена BCR-ABL в течение первых 3 месяцев лечения может использоваться для прогнозирования эффективности дальнейшей терапии больных хроническим миелолейкозом.

9 9 2. Комплексные дополнительные хромосомные аберрации в Phположительных клетках являются фактором, оказывающим влияние на выживаемость и летальность, связанную с прогрессированием хронического миелолейкоза. 3. Мутации гена BCR-ABL увеличивают частоту летальных исходов у больных вследствие прогрессирования хронического миелолейкоза и уменьшают общую выживаемость при терапии ингибиторами тирозинкиназ. 4. Сочетание дополнительных хромосомных аберраций и мутаций в киназном домене гена BCR-ABL негативно влияет на общую выживаемость и летальность от прогрессии хронического миелолейкоза. 5. Оценку вероятности достижения оптимального ответа у больных хроническим миелолейкозом целесообразно проводить с использованием программы прогнозирования эффективности таргетной терапии. Степень достоверности, публикации и апробация диссертации Степень достоверности обусловлена проведением исследований у большой группы больных (359 пациентов), использованием достоверных методов исследования, качеством проведения лабораторных анализов и статистической обработкой полученных результатов. Всего по теме диссертации опубликована 51 научная работа, включая тезисы в сборниках конференций, из которых 7 статей в журналах, рекомендованных ВАК Министерства образования и науки РФ для опубликования основных научных результатов диссертации на соискание ученой степени кандидата и доктора медицинских наук. Материалы диссертации представлены на Научном совещании исследовательской группы ХМЛ (Russian Investigators Group RING, Москва, 2014), Научном совещании Европейского общества по борьбе с лейкозами (ELN Frontiers, Берлин, Германия, 2014), 56-ом Ежегодном собрании Американского общества гематологов (56th American Society of Hematology Annual Meeting, Сан-

10 10 Франциско, США, 2014), 57-ом Ежегодном Собрании Американского Общества Гематологов (57th American Society of Hematology Annual Meeting, Орландо, США, 2015), 20-ом Конгрессе Европейской Гематологической Ассоциации (20th Congress of European Hematology Association, Вена, Австрия, 2015), 3-ей Всероссийской научно-практической конференции с международным участием «Генетика опухолей кроветворной системы» (Санкт-Петербург, 2015), III Конгрессе Гематологов России (Москва, 2016), 21-ом Конгрессе Европейской Гематологической Ассоциации (21st Congress of European Hematology Association, Копенгаген, Дания, 2016). Личный вклад автора Автором лично проведены: анализ источников литературы, планирование диссертационного исследования, сбор анамнеза, обследование, установление диагноза, назначение терапии и последующий мониторинг лечения пациентов. Также выполнялся сбор биологических образцов путем взятия крови, выполнение стернальных пункций, участие в проведении и интерпретации результатов цитогенетических и молекулярно-генетических исследований. Диссертантом лично проведены создание базы данных, последующий статистический анализ, обобщение и интерпретация полученных результатов исследования, подготовка к публикации тезисов и статей по теме работы. Самостоятельно представлял результаты исследования в печатных публикациях, выступлениях на научных конференциях. Внедрение результатов исследования в практику Программа прогнозирования эффективности таргетной терапии у больных хроническим миелолейкозом используется в практической и научноисследовательской деятельности клинического отдела «Химиотерапия гемобластозов, депрессий кроветворения и трансплантации костного мозга»

11 11 Федерального государственного бюджетного учреждения «Российский научноисследовательский институт гематологии и трансфузиологии Федерального медико-биологического агентства». Положения диссертации применяются в образовательной деятельности Федерального государственного бюджетного учреждения «Российский научно-исследовательский институт гематологии и трансфузиологии Федерального медико-биологического агентства». Структура и объем работы Диссертационная работа изложена на 114 страницах машинописного текста и состоит из введения, глав обзора литературы, описания методов и характеристики пациентов, результатов исследования, обсуждения, выводов, практических рекомендаций и списка литературы. Библиография содержит 163 источника литературы. Работа включает 27 рисунков и 19 таблиц.

12 12 Глава 1. Обзор литературы. Современные взгляды на принципы прогнозирования эффективности таргетной терапии и механизмы развития резистентности у больных хроническим миелолейкозом 1.1 Определение, этиология, распространенность, патогенез и стадии хронического миелолейкоза Хронический миелолейкоз является клональным миелопролиферативным новообразованием, развивающимся в результате злокачественной трансформации в ранних гемопоэтических предшественниках. Этиология заболевания до сих пор не установлена. Имеется ряд предположений, что может вызывать генетическую нестабильность, но пока ни одно из них не подтверждено [2, 3]. ХМЛ редкое заболевание, число первичных больных в год составляет приблизительно 1: взрослого населения. Пик заболеваемости приходится на возраст лет, около 30% больных составляют больные старше 60 лет [8]. Уникальная особенность ХМЛ это наличие специфического маркера в опухолевых клетках: транслокация (9;22), так называемая филадельфийская хромосома (Ph), приводящая к образованию патологического химерного гена BCR-ABL [3]. Белок p210 продукт деятельности этого гена представляет собой тирозинкиназу с повышенной активностью, регулирующую сигналы, ответственные за клеточный рост, активацию, дифференцировку, адгезию и апоптоз. Обнаружение Ph-хромосомы и/или гена BCR-ABL является обязательным условием для подтверждения диагноза ХМЛ. Известно, что точка разрыва в гене BCR 22-й хромосомы чаще всего находится в большой M-BCR зоне между экзонами e12-e16 (также имеющих название b1-b5), в то время как в гене ABL 9-й хромосомы эта точка находится в экзоне a2. Результатом транслокации является образование слитного гена BCR- ABL с транскриптом e13a2 (b2a2) и e14a2 (b3a2) [123]. Гораздо реже в процесс вовлекается малый кластерный регион m-bcr, при этом выявляется транскрипт e1a2 [15, 73, 119, 129]. Другие транскрипты, такие как e19a2, e2a2, e1a3, e6a2,

13 13 e13a3 (b2a3), и e14a3 (b3a3) встречаются еще реже [15, 94, 106, 121, 156]. Транскрипты e13a2 (b2a2) и e14a2 (b3a2) кодируют белок массой 210 кда (p210 BCR-ABL ), e1a2 190 кда (p190 BCR-ABL ), а e19a2 230 кда (p230 BCR-ABL ). Однозначных данных о различиях во влиянии тех или иных транскриптов гена BCR-ABL на течение ХМЛ не получено [48, 95, 97, 153]. В ходе одного исследования было доказано, что заболевание с вариантом транскрипта e1a2 протекает более агрессивно и чаще прогрессирует в продвинутые фазы [154]. Качественное определение варианта транскрипта крайне важно на этапе диагностики это играет большую роль для возможности дальнейшего мониторинга заболевания. В течение ХМЛ выделяют три фазы, отражающие степень прогрессирования заболевания: хроническую фазу (ХФ), фазу акселерации (ФА) и фазу бластного криза (БК), заболевание может быть впервые выявлено на любом этапе лечения [3]. Наибольшее распространение среди исследователей, в том числе в клинических исследованиях, получили критерии European LeukemiaNet (ELN). Предложенные в 2008, критерии ВОЗ кардинально отличаются от критериев ELN количеством определяемых бластных клеток в крови и костном мозге, а также отсутствием в них критерия обнаружения дополнительных хромосомных аберраций [19, 151]. Медиана продолжительности жизни для продвинутых фаз: ФА и БК составляет в среднем 6 12 месяцев [1, 6, 34, 56]. 1.2 Современные подходы к терапии хронического миелолейкоза Целью современной терапии ХМЛ является максимальное подавление Phположительного опухолевого клона. Стандартом лечения в настоящее время является терапия ингибиторами BCR-ABL-тирозинкиназы (ИТК), которые обладают таргетным механизмом воздействия на BCR-ABL-положительные опухолевые клетки. Применение ИТК в течение последних 15 лет позволило значительно повысить выживаемость больных ХМЛ. Первым препаратом из этой группы стал

14 14 иматиниб, его открытие совершило настоящий переворот в лечении ХМЛ. В 2000 году было начато многоцентровое рандомизированное исследование 3-й фазы IRIS по сравнению иматиниба с интерфероном-альфа в комбинации с малыми дозами цитозара у больных ХМЛ в ХФ, после чего иматиниб был одобрен в качестве терапии первой линии [117]. По результатам этого исследования 8- летняя общая выживаемость (ОВ) при лечении иматинибом составляет 85%, выживаемость без прогрессирования до ФА и БК 92% [45]. Частота прогрессирования в продвинутые фазы при терапии иматинибом более 5 лет не превышает 0,5% в год. Иматиниб относится к ингибиторам тирозинкиназ первого поколения (ИТК1), и назначается в качестве терапии первой линии большинству впервые выявленных больных ХМЛ. Вместе с тем, при терапии иматинибом, у части пациентов с ХМЛ оптимальный ответ не достигается, либо бывает утерян вследствие резистентности или непереносимости [19]. Это в свою очередь приводит к увеличению риска прогрессирования заболевания. С учетом успеха иматиниба были продолжены поиски новых препаратов для терапии ХМЛ и, начиная с 2006 г., зарегистрированы к применению препараты ИТК2: нилотиниб, дазатиниб и бозутиниб [53, 83, 110]. По результатам международных клинических исследований данные препараты были первоночально одобрены у пациентов с ХМЛ при резистентности и непереносимости иматиниба, а нилотиниб и дазатиниб также и в качестве терапии первой линии, когда была доказана их более высокая эффективность в сравнении с иматинибом [17, 19, 57, 67, 83, 110]. По существующим рекомендациям терапия ИТК должна проводиться в постоянном и непрерывном режиме, в течение всей жизни пациента, незамедлительно после подтверждения диагноза. Зачастую именно от этих факторов зависит успех терапии и увеличение продолжительности жизни пациентов с ХМЛ. Несмотря на высокую эффективность ИТК, у некоторых больных наблюдается первичная или вторичная резистентность к проводимой терапии.

15 15 Возможными причинами развития резистентности могут быть как несоблюдение протокола терапии и необоснованные перерывы в лечении, так и биологически обусловленные механизмы (BCR-ABL-зависимые или независимые) [12]. К сожалению, далеко не все механизмы резистентности при ХМЛ могут быть оценены в реальной клинической практике [125]. Резистентные больные ХМЛ требуют своевременного переключения на терапию ИТК2, а в некоторых случаях проведения аллотгск [140]. Показаниями к проведению аллотгск у больных в ХФ ХМЛ являются неудача терапии ИТК2, выявление мутации T315I [3, 19]. Тактика ведения больных в случаях резистентности или непереносимости терапии ИТК 1-3 линии должна проводиться с учетом факторов риска прогрессирования ХМЛ, переносимости ИТК и факторов риска аллотгск. У больных в ХФ ХМЛ до терапии ИТК обсуждение HLA-типирования целесообразно у больных из группы предупреждения с высокой группой риска прогрессии ХМЛ (выявление «клинически значимых» ДХА в Ph-положительных клетках) при условии низкого риска трансплантационных осложнений и наличии родственного донора [60]. Пациентам в БК ХМЛ рекомендовано проведение аллотгск от родственного или неродственного донора сразу после достижения второй ХФ на фоне ИТК и/или сочетания ИТК с химиотерапией [140]. 1.3 Определение групп риска и критерии оценки ответа на проводимую терапию С целью раннего выявления больных ХМЛ с высоким риском прогрессирования заболевания и развития резистентности к терапии введено понятие групп риска, применяемое к больным только с ХФ ХМЛ. В настоящее время в клинической практике широко используют следующие прогностические шкалы: Sokal, Hasford/EURO, EUTOS [65, 66, 143]. В 2015 г. были опубликованы данные по применению новой шкалы (ELTS The EUTOS long-term survival score) для прогнозирования ответа на терапию у больных ХМЛ при длительном

16 16 применении иматиниба, которая основана на таких характеристиках как: возраст, размеры селезенки (в см из-под края реберной дуги), количество бластов и тромбоцитов в крови [120]. Отличительной и главной особенностью этой шкалы является то, что она учитывает летальность, связанную только с прогрессией ХМЛ. Группы риска по всем вышеупомянутым шкалам рассчитываются в момент диагностики заболевания и не имеют возможности динамической оценки или рестадирования риска в ходе терапии ИТК. В дополнение к перечисленным выше шкалам согласно рекомендациям по диагностике и лечению ХМЛ ELN и Российского Национального гематологического общества (РНГО) в качестве прогностических маркеров используют результаты оценки гематологического, цитогенетического и молекулярно-генетического ответа на определенных сроках терапии (3, 6 и 12 месяцев лечения) [3, 17, 19]. Подробные характеристики видов ответов представлены в таблице 1.1 [18, 19]. В зависимости от объема лейкемического клона на каждом сроке, эффект терапии 1-й линии может быть расценен как оптимальный, предупреждение и неудача терапии (таблица 1.2). Неудача терапии предполагает низкую вероятность длительной выживаемости без прогрессии и является показанием к ее смене [102]. В данных рекомендациях делается акцент на то, что экспрессия гена BCR- ABL IS >10% после 3 месяцев терапии ИТК свидетельствует о неблагоприятном прогнозе и после подтверждения данного факта при повторном молекулярном исследовании необходимо решить вопрос о переключении на 2-ю линию терапии ИТК. Содержание BCR-ABL IS менее 10% через 3 месяца терапии обозначено как ранний молекулярный ответ (РМО). Согласно последним данным больные с РМО достигают 95% ОВ к 5-и годам терапии [63].

17 Таблица 1.1 Виды ответов на терапию ИТК у больных ХМЛ Вид ответа Определение Гематологический Полный гематологический ответ (ПГО) Лейкоциты менее 10х10 9 /л Базофилы крови менее 5% Отсутствие в крови миелобластов, промиелоцитов, миелоцитов Тромбоциты менее 450х10 9 /л Селезенка не пальпируется Цитогенетический Полный (ПЦО) Ph хромосома в метафазах не определяется (Ph+ 0%) Частичный (ЧЦО) Ph хромосома в 1-35% метафаз (Ph+ 1- Малый (МЦО) Минимальный (МинЦО) Отсутствие (нет ЦО) Молекулярный Большой молекулярный ответ (БМО) (МО 3,0 ) 17 35%) Ph хромосома в 36-65% метафаз (Ph %) Ph хромосома в 66-95% метафаз (Ph %) Ph хромосома в более 95% метафаз (Ph+ >95%) Соотношение BCR-ABL/ABL 0,1% и >0,01% по международной шкале (IS) Молекулярный ответ (МО) МО 4,0 Соотношение BCR-ABL/ABL 0,01 и >0,0032% по международной шкале (IS) или неопределяемый уровень BCR-ABL при количестве ABL 1,0х10 4 МО 4,5 МО 5,0 Соотношение BCR-ABL/ABL 0,0032% и >0,001% по международной шкале (IS) или неопределяемый уровень BCR-ABL при количестве ABL 3,2х10 4 Соотношение BCR-ABL/ABL 0,001% по международной шкале (IS) или неопределяемый уровень BCR-ABL при количестве ABL 1,0х10 5

18 [3, 19] 18 Таблица 1.2 Критерии ответа на терапию различными ИТК в первой линии Продолжительность лечения ИТК 3 месяца 6 месяцев 12 месяцев Далее в любой момент РНГО ПГО Ph+ 35% (ЧЦО) BCR-ABL IS <10% Ph+ 36% 65% (МЦО) Нет ПГО Ph+ >65% (менее МЦО) BCR-ABL IS 10% Ph+ 0% (ПЦО) BCR-ABL IS <1% Ph+ 1% 35% (ЧЦО) BCR-ABL IS 1% 10% Ph+ >35% (менее ЧЦО) BCR-ABL IS 10% потеря достигнутого ранее ответа Ответ на терапию Оптимальный ответ Предупреждение Неудача Оптимальный ответ Предупреждение ELN Ph+ 35% (ЧЦО) и/или BCR-ABL IS 10% Ph+ 36% 95% и/или BCR-ABL IS >10% Нет ПГО и/или Ph+ >95% (менееминцо) Ph+ 0% (ПЦО) и/или BCR-ABL IS <1% Ph+ 1% 35% (ЧЦО) и/или BCR-ABL IS 1% 10% Неудача Ph+ >35% (менее ЧЦО) и/или BCR-ABL IS >10% Оптимальный ответ Ph+ 0% (ПЦО) BCR-ABL IS BCR-ABL IS 0,1% (БМО) <0,1% Предупреждение Ph+ 0% (ПЦО) BCR-ABL IS BCR-ABL IS 0,1 1% 0,1 1% Ph+ >0% (менее ПЦО) BCR-ABL IS 1% потеря достигнутого ранее ответа Неудача Ph+ >0% (менее ПЦО) BCR-ABL IS 1% Оптимальный ответ BCR-ABL IS <0,1% (БМО) или лучше Предупреждение ДХА/Ph отр (-7 или 7q-) Неудача Потеря ПГО Потеря ПЦО Потеря БМО Мутации BCR-ABL ДХА/Ph полож

19 Клиническая значимость мутаций киназного домена гена BCR-ABL Около 30-40% больных ХМЛ не достигают оптимального ответа на проводимую терапию иматинибом, основной причиной чего является резистентность к лечению. Резистентность к терапии может быть первичной (отсутствие оптимального ответа на проводимую терапию) или вторичной (потеря достигнутого ранее ответа). Известно, что резистентность может развиваться на различных этапах таргетной терапии. В соответствии с рекомендациями по диагностике и лечению ХМЛ Российского Национального гематологического общества под первичной резистентностью понимают отсутствие полного гематологического ответа (ПГО), Ph+ >65% (менее МЦО) и/или недостижение РМО (BCR-ABL IS 10%) к 3 месяцам терапии; Ph+ >35% (менее ЧЦО) и BCR-ABL IS 10% к 6 месяцам; Ph+ >0% (менее ПЦО) и/или BCR-ABL IS 1% к 1 году лечения. Вторичная резистентность включает в себя потерю ПГО, ПЦО и большого молекулярного ответа (БМО), появление мутаций гена BCR-ABL и дополнительных хромосомных аберраций в Ph+ клетках, а также прогрессию заболевания в продвинутые фазы ФА и БК [3]. Механизмы, которые лежат в основе развития резистентности к ИТК разделяются на связанные с BCR-ABL-тирозинкиназой и не связанные. К BCR- ABL зависимым путям развития резистентности относят точечные мутации, амплификацию и повышенную экспрессию гена BCR-ABL. Согласно данным большого количества исследований, самой частой причиной резистентности к терапии иматинибом являются точечные мутации гена BCR-ABL, в результате которых ИТК оказываются не способными эффективно связываться с BCR-ABLтирозинкиназой и оказывать должное ингибирующее действие [22, 24, 55, 69, 141]. Первое сообщение о мутации химерного гена BCR-ABL, как причине отсутствия ответа на терапию иматинибом появилось в 2001 г. [58]. По данным исследования в группе из 9 пациентов с ХФ ХМЛ, которые достигли ПГО и ПЦО, на фоне терапии иматинибом в дозе 400 мг в сутки, а затем утратили

20 20 цитогенетический ответ, у 6 из них была обнаружена мутация T351I. При этой мутации происходит замена треонина на изолейцин в положении 315 белка BCR- ABL, что в свою очередь приводит к нарушению водородной связи между иматинибом и киназным доменом BCR-ABL. Следствием этого является реактивация BCR-ABL-опосредованной сигнальной трансдукции даже на фоне высоких доз иматиниба [9]. Эта информация дала толчок для дальнейших исследований определения резистентности больных к терапии ИТК и к настоящему времени имеется информация о более чем 90 видов точечных мутаций гена BCR-ABL [23]. Необходимо отметить, что не все обнаруженные точечные мутации гена BCR-ABL имеют клиническое значение, и различные мутации встречаются с неодинаковой частотой. В работе Hughes et al. проведен обзор частоты встречаемости мутаций у 245 пациентов (219 из которых ХМЛ и 26 Ph+ острый лимфобластный лейкоз): наиболее часто встречаемые мутации были E255K/V, M351T и T315I [70]. По данным Soverini et al., мутации M244V, G250E, Y253F/H, E255K/V, T315I, M351T и F359V составляют 85% всех мутаций, ассоциированных с резистентностью к иматинибу [146]. Вскоре после появления первых сообщений о возможности развития мутаций гена BCR-ABL были опубликованы данные по степени чувствительности in vitro разных мутантных клонов к воздействию ИТК1 (иматиниба), а позднее ИТК2 (дазатиниба, нилотиниба, бозутиниба) [33, 138, 141]. Эффективность воздействия ИТК измеряли посредством определения 50%-й максимальной ингибирующей концентрации IC 50, т.е. концентрации лекарственных средств, способной снизить на 50% фосфорилирующую активность изолированной мутантной формы ABL-киназы (биохимический тест) либо пролиферативную активность Ph-положительных клеточных линий (пролиферативный тест) [12]. Результаты этих исследований были приведены в форме таблиц с цветной кодировкой, которые улучшают наглядность различий эффективности ИТК (таблица 1.3).

21 21 Таблица 1.3 Чувствительность к ингибиторам тирозинкиназ при различных мутациях гена BCR-ABL in vitro (адаптация из Redaelli S. et al., 2009) [138] Показатели IC 50 в сравнении с «диким» типом (WT = 1) Бозутиниб Иматиниб Дазатиниб Нилотиниб Тип клеток 38,31 10,78 >50 38,43 «Дикий» тип L248V 2,97 3,54 5,11 2,80 G250E 4,31 6,86 4,45 4,56 P-петля Q252H 0,81 1,39 3,05 2,64 Y253K 0,96 3,58 1,58 3,23 E255K 9,47 6,02 5,61 6,69 E255V 5,53 16,99 3,44 10,31 С-спираль D276G 0,60 2,18 1,44 2,00 E279K 0,95 3,55 1,64 2,05 V299L 26,10 1,54 8,65 1,34 АТФ-связывающий T315I 45,42 17,50 75,03 39,41 участок F317L 2,42 2,60 4,46 2,22 SH2-домен M351T 0,70 1,76 0,88 0,44 Субстратсвязывающий участок F359V 0,93 2,86 1,49 5,16 L384M 0,47 1,28 2,21 2,33 А-петля H396P 0,43 2,43 1,07 2,41 H396R 0,81 3,91 1,63 3,10 G398R 1,16 0,35 0,69 0,49 С-концевая область F486S 2,31 8,10 3,04 1,85 Чувствительный 2 Умеренно чувствительный 2,01-4 Резистентный 4,01-10 Высокорезистентный >10 Дальнейшие исследования роли точечных мутаций показали, что результаты, полученные in vitro являются ценными для предсказания чувствительности к терапии у больных с резистентностью, но полностью не могут быть применимы на ситуацию in vivo. Представленные результаты могут быть примерным ориентиром при выборе терапии тем или иным ИТК, потому что в

22 22 развитии резистентности участвуют и другие факторы (активация BCR-ABLнезависимых путей, клональная эволюция и нарушение активности белковтранспортеров), особенно в случаях обнаружения редких мутаций, клиническая значимость которых до конца не изучена [12]. Еще одним важным и дискуссионным моментом в детекции мутаций гена BCR-ABL является методика, применяющаяся для их выявления. На сегодняшний день имеются следующие методы определения мутаций гена BCR-ABL: прямое ДНК-секвенирование, клонирование с последующим секвенированием, денатурирующая высокоэффективная жидкостная хроматография с последующим секвенированием, пиросеквенирование, двойной градиентный денатурирующий электрофорез, аллель-специфическая полимеразная цепная реакция (ПЦР), мультиплексный анализ однонуклеотидного полиморфизма, масс-спектрометрия [9, 22, 43, 68, 87, 113, 132, 133, 144, 157, 162]. Основными отличиями методик считаются чувствительность метода (которая колеблется от 0,1 до 20%), возможность определения всего спектра мутаций, количественная оценка мутантного клона, и, что играет немаловажную роль это стоимость и распространенность [20]. Наибольшее распространение получил метод прямого секвенирования. Рекомендованным методом определения мутаций гена BCR-ABL является прямое секвенирование (секвенирование по Сэнгеру) [136, 137, 147]. Мутационный статус необходимо определять [3, 19, 147]: в дебюте заболевания ХМЛ в ФА и БК; при терапии 1-й линии иматинибом: - при неудаче терапии (по рекомендациям ELN 2013, РНГО 2015); - при росте уровня экспрессии гена BCR-ABL и потере БМО (>0,1% IS);

23 23 - при субоптимальном ответе (наличии факторов предупреждения); при терапии 2-й линии дазатинибом или нилотинибом: - в случае потери гематологогического или цитогенетического ответов, а также перед сменой ИТК. Четких рекомендаций по определению мутационного статуса у больных, получающих ИТК2 в качестве терапии первой линии терапии в настоящее время не имеется, но можно с уверенностью сказать, что мутации гена BCR-ABL необходимо определять в случае неудачи терапии одним из ИТК. Выбор любого из ИТК2 при смене терапии должен проводиться с учетом мутационного статуса [3]. По мере накопления информации было доказано, что мутации гена BCR- ABL чаще выявляются в продвинутых фазах заболевания, чем в хронической фазе с общей частотой: в ХФ 35%, ФА более чем в 50% и в фазе БК 80% [19, 147]. Наиболее часто встречаемыми мутациями (в 85% случаев) являются: M244V, G250E, Y253F/H, E255K/V, T315I, F317L, M351T, E355G, F359C/V, H396R/P, M237I, Q252H/R, D276G, L248V, F486S [147]. В ходе исследований определения клинического значения определения мутаций гена BCR-ABL, было продемонстрировано, что обнаружение этих мутаций у резистентных к иматинибу пациентов приводит к большей частоте прогрессирования в продвинутые фазы заболевания, и как следствие этого к уменьшению общей выживаемости [22, 27, 41, 57, 68, 76, 88, 114, 138, 141, 145, 146]. Открытие и внедрение в практику ИТК2 показало, что нилотиниб, дазатиниб и бозутиниб способны преодолевать резистентность, которая возникла в ходе терапии к иматинибу, в том числе ингибировать большинство мутантных генов BCR-ABL [84, 111, 138]. Однако, ни один из этих препаратов неактивен в отношении мутации T315I [16, 35, 83, 84, 110, 142]. До последнего времени единственным методом терапии оставалась аллотгск [115]. Доклинические исследования нового ингибитора тирозинкиназ понатиниба открыли новые перспективы в лечении резистентных больных [118]. В 2012 году получены

24 24 результаты о его эффективности у пациентов ранее резистентных ко всем ИТК, в том числе с наличием мутации T315I, большой цитогенетический ответ был получен у 92% [38]. Суммируя данные исследований применения ИТК2 в отношении резистентных к иматинибу мутаций гена BCR-ABL можно сделать следующие выводы: - при определении мутаций T315A, F317V/L/I/C, V299L, E255V и Q252H предпочтительна терапия нилотинибом; - при выявлении мутаций Y253H, F359V/C/I, E255K/V показана терапия дазатинибом; - мутации G250E и E255K имеют низкую чувствительность к бозутинибу; - мутации E255H и H396R обладают низкой чувствительностью в отношении понатиниба; - мутация T315I решение вопроса о возможности проведения аллотгск, понатиниб, клинические исследования; - любые другие мутации повышение дозы иматиниба, нилотиниба, дазатиниба. Более подробная информация чувствительности мутаций к различным ИТК представлена в таблице 1.4. В 2014 году появились первые публикации о результатах доклинического исследования еще одного ИТК PF-114, который продемонстрировал высокую активность ингибирования BCR-ABL-тирозинкиназы, а также способность преодолевать резистентность всех имеющихся мутаций, в том числе T315I [107]. В начале 2016 года начата I-ая фаза клинических исследований данного препарата.

25 25 Таблица 1.4 Чувствительность in vitro (IC 50 ) и частота достижения цитогенетического ответа на терапию дазатинибом, нилотинибом, бозутинибом и понатинибом в зависимости от выявленных мутаций гена BCR-ABL методом прямого секвенирования (адаптация из Baccarani M. et al., 2014) [19, 21, 38, 39, 62, 84, 111] Мутация Дазатиниб Нилотиниб Бозутиниб Понатиниб БЦО IC 50 БЦО IC 50 БЦО IC 50 БЦО IC 50 M244V 59% (27/46) 1,3 70% (7/10) 38 НД (2/3) % (5/7) 2,2 L248V 66% (10/15) 9,4 НД 0/ НД НД НД (1/2) 4,0 G250E 48% (29/60) 1,8-8,1 НД (3/4) (0/5) % (8/11) 4,1 Q252H 16% (1/6) 3,4-5,6 НД НД 34 НД 2,2 Y253H 65% (15/23) 1, % (1/7) % (4/6) НД НД (1/2) 6,2 E255K 56% (9/16) 5, % (1/5) НД (0/1) % (6/8) 14 E255V 36% (4/11) 6,3-11 НД (0/1) НД (0/1) 230 НД (0/2) 36 D276G 50% (4/8) 2,6 НД (1/2) 35 НД 25 НД НД E279K 62% (5/8) 3,0 НД (1/2) НД 40 НД НД T315I 9% (2/21) >1000 НД (0/4) > (0/6) % (57/78) 11 F317L 14% (2/14) 7,4-18 НД (0/2) НД (0/1) % (14/27) 1,1 M351T 52% (28/54) 1,1-1,6 54% (6/11) 7,8-3,9 НД (0/1) 29 НД (2/3) 1,5 E255G 47% (9/19) НД НД (2/3) НД НД НД НД НД F359C 60% (3/5) НД НД НД НД (1/2) НД 40% (2/5) 6,0 F359I 83% (10/12) НД НД (0/2) НД НД (2/2) НД НД (4/4) НД F355V 63% (17/27) 2, % (3/8) НД (1/2) 39 56% (7/14) 10 H396R 51% (17/33) 1,3-3,0 60% (3/5) НД (0/1) 34 16% (1/6) 4,0 E455K 50% (6/12) НД НД (0/2) НД НД НД НД (3/3) 5,0 F486S 46% (6/13) 5,0 НД (0/2) НД 96 НД НД Нет данных Чувствительный >75% Умеренно чувствительный 50-75% Резистентный 25-50% Высокорезистентный <25% Примечания 1 НД нет данных. 2 Приведен список мутаций, которые определялись более чем у 10 пациентов. 3 Частота ответов приведена как достижение БЦО (Ph+ от 1 до 35%), в скобках приведено количество пациентов с указанной мутацией, и доля достигших БЦО. 4 Все приведенные мутации резистентны к терапии иматинибом.

26 Клиническое значение дополнительных хромосомных аберраций К BCR-ABL-независимым механизмам развития резистентности сегодня принято относить развитие ДХА, активацию альтернативных сигнальных путей, феномен множественной лекарственной устойчивости [3, 19, 28, 31, 59, 160]. Как правило, активация альтернативных сигнальных путей является следствием развития ДХА, новых соматических мутаций и изменений в эпигенетической регуляции опухолевых клеток [7]. У пациентов с резистентностью к ИТК была описана активация сигнальных путей PI3K/Akt/mTOR, Jak2/STAT-5, Ras/Raf/MAPK [31, 28, 160]. Исследования в этом направлении не получили широкого распространения в клинической практике по причине высокой финансовой затратности, как в ходе определения резистентности, так и в последующем лечении этих пациентов. Клинические исследования определения множественной лекарственной устойчивости в первую очередь были направлены на поиск взаимосвязи P- гликопротеина (который кодируется геном MDR1, и выполняет активное выведение лекарственных препаратов из клетки) и формирования резистентности к терапии ИТК. В ходе этих исследований не было доказано влияние гиперэкспрессии P-гликопротеина (MDR1) на развитие резистентности к иматинибу [158]. Влияние MDR1 в ходе клинических исследований на развитие резистентности к ИТК2 также не было подтверждено и, возможно, требует дальнейшего изучения [32, 82, 100]. Наибольшее значение среди BCR-ABL-независимых механизмов развития резистентности остаются ДХА. До внедрения в клиническую практику ИТК обнаружение ДХА однозначно ассоциировали с прогрессией заболевания и быстрой гибелью пациентов [5, 36, 37]. Применение ИТК1 и ИТК2 позволило добиваться оптимальных ответов у значительной части пациентов, и поэтому факт развития ДХА требовал пересмотра.

27 27 Известно, что на момент диагноза у 10-12% пациентов с ХМЛ определяются хромосомные аномалии помимо стандартной Ph-хромосомы. Среди этих аномалий выявляются вариантные транслокации, которые не оказывают негативного влияния на течение ХМЛ [30, 96, 104]. Остальные дополнительные хромосомные аномалии в Ph-положительных (Ph полож ) клетках обнаруживаются у меньшего количества пациентов (5%) и подразделяются на «значимые» («major route») и «незначимые» («minor route») [108, 109]. «Значимые» аберрации (трисомия 8 и 19 хромосомы, дополнительная Ph-хромосома (+der(22)t(9;22)(q34;q11)), изохромосома 17 (i(17)(q10)), шесть «незначимых» ДХА (-7, -17, +17, +21 и -Y) и одна структурная аберрация t(3;21)(q26;q22), изначально были описаны Mitelman et al. в 1976 г. [109]. Однако, классификация, предложенная авторами, основывается только на частоте выявления ДХА. Дальнейшие исследования были направлены на изучение влияния ДХА на исход лечения, и к настоящему моменту совершенно очевидно, что ситуация остается неясной [61]. Первое крупное ретроспективное исследование влияния ДХА было проведено немецкой группой исследователей (German CML Study IV) [47]. Были проанализированы данные 1151 больных ХМЛ, из которых на момент диагноза 3,6% (n=41) имели ДХА. После медианы наблюдения 5,3 лет для пациентов с «незначимыми» и «значимыми» ДХА 5-летняя выживаемость без прогрессии составила 96% и 50%, а общая выживаемость 96% и 53%, соответственно. В этих клинических испытаниях применялись различные дозировки иматиниба, а также его комбинация с интерфероном-альфа и цитарабином. Учитывая, что комбинация иматиниба с вышеуказанными препаратами не продемонстрировала своего превосходства, применение этих данных не совсем корректно в эру ИТК. В схожем исследовании итальянской группы ученых (GIMEMA) были подвергнуты анализу данные диагностики и лечения 559 больных ХМЛ [96]. В результате было показано, что пациенты, у которых были обнаружены ДХА (5,6% от общего числа пациентов, n=21) в момент диагноза статистически значимо реже

28 28 достигают ПЦО и БМО. В отличие от данных, полученных немецкой группой, в этом анализе не было показано значимого влияния ДХА на выживаемость. Здесь также стоит отметить, что все предыдущие исследования не оценивали влияния изолированных хромомосомных перестроек, а проводили оценку «значимых» ДХА у больных с комплексными аномалиями, что очень часто происходит в ходе клональной эволюции, и приводит к некоторому искажению результатов. «Незначимые» хромосомные перестройки незаслуженно остаются малоизученными, доказательством этому служит последнее исследование группы американских ученых Wang et al. [159]. Авторы предлагают разделить пациентов ХМЛ на группы прогноза согласно цитогенетическиму профилю по аналогии с миелодиспластическими синдромами и острыми лейкозами. В данном исследовании акцент сделан на изолированном выявлении ДХА, и согласно полученным данным, все предыдущие утверждения требуют пересмотра. В группу с «хорошим прогнозом» отнесены трисомия 8 хромосомы, удвоение Phхромосомы и Y, а в группу с относительно «плохим прогнозом» i(17)(q10), - 7/del7q и перестройки 3(q26.2). Таким образом, ранее относившиеся другими авторами к группе высокого риска +8 и +Ph продемонстрировали большую частоту ответов и лучшую выживаемость по сравнению с другими ДХА, а такие аномалии как -7/del7q и аберрации 3(q26.2) предлагается относить в группу с высоким риском прогрессирования. При сравнении группы «плохого прогноза» с больными без ДХА, также была показана меньшая выживаемость, независимо от фазы заболевания и времени выявления ДХА. В противоположность этому факту, ДХА из группы «хорошего прогноза» не оказывали негативного влияния на выживаемость, только если они обнаруживаются в хронической фазе или в момент постановки диагноза. Одновременное выявление двух и более ДХА также оказывает отрицательное влияние на выживаемость и такие пациенты могут быть отнесены в группу «плохого прогноза». Ситуация, при которой происходит обнаружение ДХА в Ph-положительных клетках в ходе терапии получила название клональной эволюции. Мартынкевич и

29 29 соавт. в 2007 г. показали, что обнаружение клональной эволюции в ходе терапии иматинибом в Ph-положительных клетках достоверно ухудшает результаты терапии по сравнению с больными только с Ph-хромосомой [10]. По данным исследования ГНЦ было продемонстрировано, что 86% пациентов в ХФ с аномалиями в Ph-положительных клетках имели цитогенетическую резистентность, при этом их общая 5-летняя выживаемость составила 80%, что достоверно ниже, чем у пациентов без ДХА (p<0,005). При возникновении дополнительной Ph-хромосомы или амплификации гена BCR-ABL добиться полного подавления Ph-положительного клона возможно только у трети больных лишь при использовании ИТК2; а присутствие дополнительных аномалий хромосомы 7 и комплексных нарушений кариотипа с вовлечением изохромосомы i(17)(q10) является признаком неблагоприятного прогноза, подразумевающего отсутствие эффекта от терапии ИТК1 и ИТК2 [5]. Клональные цитогенетические аберрации в Ph-отрицательных (Ph отр ) клетках встречаются у 5-10% пациентов, и они не оказывают никакого влияния на эффективность терапии, если при этом отсутствует дисплазия [19, 44, 92]. Исключение составляет аберрации 7 хромосомы (моносомия 7 и del(7q)), при выявлении которой имеются сообщения о развитии миелодисплазии и риска трансформации в острый лейкоз. На сегодняшний день согласно рекомендациям ELN 2013 и РНГО 2015 развитие клональной эволюции считается неудачей терапии, а наличие ДХА в момент диагностики расценивается как предостережение [3, 19]. Выявление «значимых» ДХА в ходе терапии ИТК у пациентов с ХФ ХМЛ свидетельствует о прогрессии заболевания в продвинутые фазы и требует незамедлительных действий [19, 44, 92, 128, 155]. 1.6 Влияние сочетанного обнаружения дополнительных хромосомных аномалий и мутаций гена BCR-ABL На данный момент в литературе имеется лишь несколько сообщений о

30 30 сочетанном влиянии ДХА и точечных мутаций гена BCR-ABL на прогноз и течение ХМЛ. Первое исследование, опубликованное в 2010 г. было направлено на определение наличия взаимосвязи возникновения ДХА и мутаций, клиническое значение при этом не оценивалось. В исследовании Schnittger et al., в которое было включено 205 пациентов с ХМЛ с приобретенной резистентностью к терапии иматинибом, впервые показано сочетание ДХА и мутаций гена BCR- ABL, и наблюдалось в 36,7% (29 из 79) случаев. ДХА чаще всего обнаруживались в случаях со следующими мутациями: E255V (2/3), T315I (8/18), F317L (4/7), F359C/V (4/7), или H396R (2/3), и всего в одном случае из 9 при мутации M351T. Таким образом, сделаны выводы, что некоторые точечные мутации (например T315I) могут быть ассоциированы с большей генетической нестабильностью и оказывать влияние на развитие ДХА и другие молекулярно-генетические события [150]. Kim et al. оценивали влияние ДХА и мутаций гена BCR-ABL на эффективность терапии нилотинибом после неудачи терапии иматинибом у больных ХМЛ. В исследовании проанализированы данные 53 пациентов (ХФ n=38, ФА n=5 и БК n=10). Двухлетняя ОВ у пациентов в ХФ ХМЛ составила 100% без ДХА и 62% с наличием ДХА, соответственно (p=0,0024). Также было показано, что сочетание ДХА и мутаций в общей группе значительно ухудшает прогноз заболевания и повышает риск трансформации в продвинутые фазы [90]. Негативное влияние сочетания ДХА и точечных мутаций было доказано еще в одном исследовании, где проанализированы данные 71 пациента с резистентностью к проводимой терапии иматинибом. После неудачи терапии иматинибом 57 пациентов были переведены на терапию ИТК2: нилотиниб и дазатиниб, 6 из которых имели сочетание ДХА и мутаций, и 4-х летняя ОВ составила 33% (p<0,001) [105]. Следует учесть, что в это исследование были включены также пациенты с БК ХМЛ на момент диагностики (n=8) и с Phположительным острым лимфобластным лейкозом (n=6).

31 Индивидуализация терапии ингибиторами тирозинкиназ у больных хроническим миелолейкозом В последние годы появились исследования, авторы которых обращают внимание не только на объем лейкемического клона на определенных сроках терапии ИТК при ХМЛ (3, 6 и 12 месяцев терапии), но и оценивают индивидуальные характеристики ответа на лечение, а именно клиренс опухолевого клона, определяемый при ХМЛ как скорость снижения уровня BCR- ABL или соотношение экспрессии BCR-ABL [25, 64]. В одном из таких исследований (Hanfstein et al.) показано прогностическое значение скорости снижения соотношения уровней экспрессии BCR-ABL через 3 месяца терапии и на момент диагностики. Результаты определения уровня экспрессии BCR-ABL в этом исследовании были представлены по отношению к экспрессии гена GUS, который в настоящее время редко используют в качестве контрольного гена для определения относительного уровня BCR-ABL. Оценку информативности соотношения уровня экспрессии BCR-ABL/ABL при применении стандартного мониторинга авторы этого исследования не проводили. Одним из обсуждаемых препятствий для применения уровня BCR-ABL/ABL в момент диагностики является искажение (нелинейность) результатов измерения значений экспрессии гена BCR-ABL выше 10% [64]. В исследовании Branford et al. продемонстрирована возможность применения для прогнозирования эффективности терапии ИТК, так называемой «двукратной скорости снижения экспрессии BCR-ABL». В группе больных, у которых не было достигнуто снижения уровня экспрессии BCR-ABL менее 10% через 3 месяца терапии дополнительно проводили оценку «двукратного снижения». Отмечено, что при «двукратном снижении» менее чем за 76 дней 4- летняя ОВ была значительно выше, чем при значении более 76 дней: 95 и 58% соответственно (p = 0,0002). Кроме того, БМО на протяжении всего наблюдения получен у 54% больных в первой группе и только у 5% во второй группе (p = 0,008) [25].

32 32 Таким образом, внедрение в клиническую практику ИТК для лечения пациентов с ХМЛ совершило настоящий переворот в понимании биологических особенностей этого, ранее трудно поддающегося лечению, новообразования. При применении ИТК1 и ИТК2 у большей части пациентов удается достичь полной редукции опухолевого клона, и в настоящее время проводится большое количество научных исследований о возможности ведения пациентов без лечения ИТК [74, 93, 101, 130, 134, 135, 139]. Несмотря на достигнутые успехи, часть пациентов остается резистентной к проводимой таргетной терапии ингибиторами тирозинкиназ как первого, так и последующих поколений. Основными причинами низкой эффективности терапии признаны первичная и вторичная резистентность, обусловленная биологическими особенностями опухолевого клона, низкая приверженность к терапии и неудовлетворительная переносимость (гематологическая и негематологическая токсичность). Вклад мутаций гена BCR-ABL в развитие приобретенной резистентности к ИТК1 и ИТК2 к настоящему моменту довольно хорошо изучен и на основании имеющихся данных, разработаны рекомендации по ведению пациентов с определенным мутационным статусом. Спорными вопросами остаются частота и спектр выявляемых мутаций, а также их потенциальное значение в генезе первичной резистентности. К сожалению, нельзя сказать тоже самое относительно степени разработанности понимания BCR-ABL-независимых путей резистентности, а именно о роли ДХА. С учетом последних публикаций в области исследования влияния ДХА на течение ХМЛ этот вопрос требует пересмотра прогностических критериев оценки ДХА. Учитывая доказанное негативное влияние ДХА и точечных мутаций гена BCR-ABL, в настоящее время интересным представляется изучение их влияния при сочетанном выявлении на прогноз заболевания и эффективность таргетной терапии больных ХМЛ, а недостаточное количество публикацнй на данную тему обосновывает необходимость выполнения дополнительных исследований. Имеющиеся прогностические шкалы и суррогатные маркеры позволяют определить больных ХМЛ с высоким риском прогрессирования заболевания, но

33 33 они не берут в расчет индивидуальную скорость элиминации опухолевого клона [3, 14, 17, 19, 65, 66, 102, 143]. В последних рекомендациях по ведению больных с ХМЛ сделан акцент на том, что уровень экспрессии гена BCR-ABL более 10% после трех месяцев терапии ИТК свидетельствует о неблагоприятном прогнозе и такие пациенты требуют решения вопроса о переключении на 2-ю линии терапии ИТК. Так как после начала терапии ИТК у больных ХМЛ происходит быстрое снижение размеров опухолевой массы, гипотеза о потенциальном прогностическом значении скорости снижения уровня BCR-ABL во время лечения представляется заслуживающей внимания. Необходимо провести комплексную оценку роли биологических характеристик (мутаций в киназном домене гена BCR-ABL, дополнительных хромосомных аберраций, динамики уровня экспрессии BCR-ABL в течение первых трех месяцев лечения) в формировании резистентности и разработать программу прогнозирования эффективности таргетной терапии у больных хроническим миелоидным лейкозом.

34 34 Глава 2. Методы исследования и характеристика пациентов 2.1 Дизайн исследования Для решения задач исследования было запланировано проведение трех этапов. На первом этапе проведена оценка роли динамики уровня экспрессии гена BCR-ABL. В ходе проспективного анализа построена обучающая выборка, затем с помощью ROC-анализа определено пороговое значение соотношения уровней экспрессии BCR-ABL через 3 месяца и в момент диагностики. После этого проведен анализ возможности использования динамики уровня экспрессии гена BCR-ABL в сравнении с ранним молекулярным ответом для прогнозирования достижения оптимального ответа к 1 году терапии. Первоначально анализ был выполнен на обучающей выборке, а затем проведена валидация полученных результатов на независимой контрольной выборке больных. В рамках второго этапа исследования выполнен ретроспективный анализ данных больных ХМЛ. Отдельно проанализированы выборка пациентов с наличием ДХА и выборка, включающая пациентов с различным мутационным статусом. Для предварительного определения возможного влияния ДХА и мутаций гена BCR-ABL на общую выживаемость и кумулятивную частоту летальных исходов, связанных с прогрессией ХМЛ больные с ДХА и мутациями были стратифицированы по различным признакам, после чего осуществлялся регрессионный анализ. На основании результатов регрессионного анализа произведен сравнительный анализ влияния наиболее значимых признаков на выживаемость и частоту летальных исходов от прогрессии ХМЛ. В ходе этого этапа также проведена оценка сочетанного влияния наличия ДХА и мутаций киназного домена гена BCR-ABL. На третьем этапе исследования были обобщены данные о динамике уровня экспрессии гена BCR-ABL, значимых ДХА в Ph-положительных клетках,

35 35 мутациях киназного домена BCR-ABL и разработана комплексная программа прогнозирования эффективности таргетной терапии у больных ХМЛ. 2.2 Характеристика исследуемой группы пациентов Всего в исследование было включено 359 пациентов с ХМЛ. Клинические и лабораторные характеристики были следующими: наличие жалоб 208 (58%), размеры селезенки пальпаторно ниже реберной дуги, среднее значение (95% д.и.) 3,4 см (2,6-4,23), размеры печени пальпаторно ниже реберной дуги, среднее значение (95% д.и.) 0,9 см (0,7-1,2), гемоглобин, среднее значение (95% д.и.) 118 г/л ( ), эритроциты, среднее значение (95% д.и.) 3,8 х 10 9 /л (3,6-3,9), лейкоциты, среднее значение (95% д.и.) 103,2 х 10 9 /л (89,2-117,2), бласты, среднее значение (95% д.и.) 2,1% (1,6-2,6), базофилы, среднее значение (95% д.и.) 5,0% (4,4-5,6), эозинофилы, среднее значение (95% д.и.) 2,8% (2,4-3,2), тромбоциты, среднее значение (95% д.и.) 471 х 10 9 /л ( ). В результате анализа клинических и лабораторных проявлений заболевания между подгруппами, включенными в различные этапы исследования, статистической значимости получено не было. В ходе проведения первого этапа были проанализированы данные 43 пациентов ХМЛ (обучающая выборка), соответствующих критериям включения и исключения. В анализ вошли пациенты с установленным диагнозом ХМЛ в период с 2012 по 2016 гг. Критериями включения были: 1. Диагноз ХФ ХМЛ. 2. Наличие данных кариологического анализа в момент диагностики. 3. Наличие данных об уровне экспрессии BCR-ABL в момент диагностики. 4. Наличие данных цитогенетического исследования клеток костного мозга через 3, 6 и 12 месяцев терапии ИТК.

36 36 5. Наличие данных об уровне экспрессии гена BCR-ABL через 3, 6 и 12 месяцев терапии ИТК. 6. Наличие данных о режиме терапии, дозе ИТК и данных о приверженности к терапии. Критериями исключения являлись: 1. Продвинутые фазы ХМЛ (ФА и БК): a. Критерии фазы акселерации ХМЛ: i % бластных клеток в крови и/или костном мозге; сумма бластов и промиелоцитов 30% (при этом бластов <30%). ii. Количество базофилов в крови 20%; персистирующая тромбоцитопения <100х10 9 /л, не связанная с терапией. iii. ДХА в Ph-положительных клетках (трисомия по 8 и 19 хромосоме, удвоение Ph-хромосомы, изохромосома 17(i(17)(q10)), и ider (22)(q10)t(9;22)(q34;q11)). b. Критерии бластного криза: i. Наличие в крови или в костном мозге 30% бластных клеток. ii. Появление экстрамедуллярных инфильтратов бластных клеток. 2. Наличие атипичных транскриптов гена BCR-ABL. ФА или БК устанавливались при наличии хотя бы одного критерия. При отсутствии признаков ФА и БК больные относились в ХФ [3, 19]. Медиана возраста в обучающей выборке составила 50 лет (мин макс, года), 17 мужчин и 26 женщин. Восемь пациентов имели высокий риск EUTOS. Распределение по шкале Sokal было следующим: 23 низкий, 10 промежуточный и 10 высокий. Тридцать пациентов получали терапию иматинибом в дозировке 400 мг в сутки, 12 нилотинибом 600 мг в сутки и 1 дазатинибом 100 мг в сутки. Медиана экспрессии гена BCR-ABL на момент диагностики (IS) составила 18,89% (мин макс, 3, ,36%).

37 37 Мониторирование уровня экспрессии BCR-ABL проводили у всех пациентов методом количественной ПЦР в режиме реального времени в момент диагностики и через 3, 6 и 12 месяцев терапии ИТК, оценку экспрессии BCR-ABL выполняли по отношению к экспрессии гена ABL. У 10 пациентов из этой группы уровень BCR-ABL оценивали также и через 1 месяц терапии. Оптимальным ответом к 1 году терапии ИТК считали достижение БМО [3, 14, 17, 19]. С целью валидации результатов, в исследование дополнительно включены 58 пациентов ХМЛ (контрольная выборка), которые соответствовали тем же критериям включения и исключения. Клинико-лабораторные характеристики пациентов представлены в таблице 2.1. Таблица 2.1 Клинико-лабораторная характеристика больных ХМЛ на момент установления диагноза (контрольная выборка) Число больных Клинико-лабораторные характеристики абс. % Возраст (медиана), годы 52 (19 80) Пол: м ж Группы риска EUTOS: низкий риск высокий риск Группы риска Sokal: низкий риск промежуточный высокий риск Медиана экспрессии гена BCR-ABL на момент диагностики (IS), % Терапия 1-й линии: иматиниб 400 мг/сут нилотиниб 600 мг/сут дазатиниб 100 мг/сут ,5 15,5 32,8 43,1 24,1 40,92 (0,44 321,25) Всего больных ,2 3,4 3,4

38 38 В соответствии со второй задачей исследования проведен ретроспективный анализ больных ХМЛ, диагноз которым был подтвержден в период с 2005 по 2015 год в лаборатории молекулярной генетики «Российского научноисследовательского института гематологии и трансфузиологии» в терапии первой линии которых использовались таргетные препараты. За этот период диагноз ХМЛ верифицирован у 782 пациентов. Из них дополнительные хромосомные аберрации в Ph полож -клетках как до терапии, так и во время проведения лечения выявлены у 92 (12%) пациентов, ДХА в Ph отр - клетках у 12 (2%) и вариантные транслокации Ph-хромосомы обнаружены у 32 (4%) больных. Обязательными критериями включения были: подтвержденный стандартным цитогенетическим методом диагноз ХМЛ в ХФ и ФА, наличие типичного транскрипта BCR-ABL, терапия ИТК1 и ИТК2, подписанное информированное согласие на включение в наблюдательное исследование, возраст старше 18 лет. Критериями исключения из исследования: аллотгск, выполненная на любом этапе терапии и фаза бластной трансформации на момент диагноза. Всем критериям включения и исключения соответствовали 30 пациентов с ДХА в Ph полож -клетках, 7 с ДХА Ph отр -клетках и 9 с вариантными транслокациями. В качестве группы сравнения проанализированы данные 110 пациентов с стандартной Ph-хромосомой. Клинико-лабораторные характеристики пациентов приведены в таблице 2.2 и 2.3. Общая летальность в анализируемой группе составила 12% (n=19), из них 6% (n=9) по причине прогрессии заболевания. Эффективность проводимой терапии, перевод на ИТК2, а также цитогенетический и молекулярный мониторинг проводили в соответствии с актуальными на момент оценки рекомендациями [3, 19, 20]. Фаза заболевания ХМЛ определялась в соответствии с рекомендациями ELN [20].

39 39 Таблица 2.2 Характеристика больных ХМЛ с дополнительными хромосомными аномалиями и стандартной Ph-хромосомой на момент установления диагноза (n=156) Показатель Пол Мужчины Женщины Возраст на момент диагноза (медиана), годы Медиана наблюдения от даты диагноза, месяцы Медиана наблюдения от даты выявления ДХА, месяцы Фаза заболевания на момент диагноза: ХФ ФА Терапия 1-й линии Иматиниб Нилотиниб Дазатиниб Статус Умер Жив Всего (n=156) 70 (45%) 86 (55%) Только Ph (n=110) 46 (42%) 64 (58%) ДХА в Ph полож (n=30) 16 (53%) 14 (47%) ДХА в Ph отр (n=7) 3 (43%) 4 (57%) Вариантные Ph (n=9) 5 (56%) 4 (44%) 50 (18-84) 50 (18-84) 47 (20-75) 51 (25-54) 50 (29-70) 65 (1-131) 56 (1-131) 77 (14-124) 105 (77-113) 94 (43-113) 145 (93%) 11 (7%) 146 (94%) 9 (5%) 1 (1%) 51 (3-124) 60 (41-104) 109 (99%) 1 (1%) 104 (95%) 6 (5%) 0 (0%) 23 (77%) 7 (23%) 26 (87%) 3 (10%) 1 (3%) 6 (86%) 1 (14%) 7 (100%) 0 (0%) 0 (0%) 7 (78%) 2 (22%) 9 (100%) 0 (0%) 0 (0%) 19 (12%) 12 (11%) 6 (20%) 1 (14%) 137 (88%) 98 (89%) 24 (80%) 6 (86%) Смерть от прогрессии 9 (6%) 4 (4%) 5 (17%) 0 (0%) 0 (0%) 0 (0%) 9 (100%) Таблица 2.3 Распределение больных ХМЛ с дополнительными хромосомными аномалиями и стандартной Ph-хромосомой на момент установления диагноза по группам риска (n=156) Группы риска Всего (n=156) Только Ph (n=110) ДХА в Ph полож (n=30) ДХА в Ph отр (n=7) Вариантные Ph (n=9) Sokal: низкий промежуточный высокий Hasford: низкий промежуточный высокий EUTOS: низкий высокий ELTS: низкий промежуточный высокий 76 (49%) 47 (30%) 33 (21%) 69 (44%) 70 (45%) 17 (11%) 147 (94%) 9 (6%) 96 (62%) 43 (27%) 17 (11%) 63 (57%) 31 (28%) 16 (15%) 53 (48%) 50 (46%) 7 (6%) 108 (98%) 2 (2%) 77 (70%) 25 (23%) 8 (7%) 6 (20%) 10 (33%) 14 (47%) 11 (37%) 11 (37%) 8 (26%) 25 (83%) 5 (17%) 10 (33%) 14 (47%) 6 (20%) 4 (57%) 2 (29%) 1 (14%) 3 (43%) 3 (43%) 1 (14%) 6 (86%) 1 (14%) 5 (72%) 1 (14%) 1 (14%) 3 (33%) 4 (45%) 2 (22%) 2 (22%) 6 (67%) 1 (11%) 8 (89%) 1 (11%) 4 (45%) 3 (33%) 2 (22%)

40 40 Для исследования мутационного статуса гена BCR-ABL в лабораторию молекулярной генетики РосНИИГТ поступило 434 образца крови пациентов. Из них мутации обнаружены у 110 (25%) пациентов. Для исследования задачи в анализ включены данные 102 пациентов (согласно критериям включения и исключения), диагноз которым установлен после 2005 года и было выполнено исследование мутационного статуса гена BCR-ABL. Характеристики больных представлены в таблице 2.4 и 2.5. Данные для полноценного анализа получены из наблюдательного исследования CSTI571ARU06 «Российского регистра по лечению ХМЛ в рутинной клинической практике» [11]. Таблица 2.4 Характеристика пациентов ХМЛ с исследованным мутационным статусом (n=102) Показатель Пол Мужчины Женщины Возраст на момент диагноза (медиана), годы Медиана наблюдения от даты диагноза, месяцы Медиана наблюдения от даты исследования, месяцы Фаза заболевания на момент диагноза: ХФ ФА Терапия 1-й линии Иматиниб Нилотиниб Дазатиниб Всего (n=102) 52 (51%) 50 (49%) Пациенты с мутациями (n=53) 30 (57%) 23 (43%) Пациенты без мутаций (n=49) 22 (45%) 27 (55%) 46 (18-81) 46 (20-75) 44 (18-81) 63 (3-134) 70 (4-134) 53 (3-127) 22 (0-75) 21 (0-40) 23 (0-75) 90 (88%) 12 (12%) 100 (98%) 1 (1%) 1 (1%) 42 (79%) 11 (21%) 52 (98%) 1 (2%) 0 (0%) 48 (98%) 1 (2%) 48 (98%) 0 (0%) 1 (2%) Статус Умер 17 (17%) 14 (26%) 3 (6%) Жив 85 (83%) 39 (74%) 46 (94%) Смерть от прогрессии 12 (12%) 11 (21%) 1 (2%)

41 41 Таблица 2.5 Распределение больных ХМЛ с исследованным мутационным статусом по группам риска (n=102) Группы риска Всего (n=102) Пациенты с мутациями (n=53) Пациенты без мутаций (n=49) Sokal: низкий промежуточный высокий Hasford: низкий промежуточный высокий EUTOS: низкий высокий ELTS: низкий промежуточный высокий 29 (29%) 28 (27%) 45 (44%) 41 (40%) 38 (37%) 23 (23%) 83 (81%) 19 (19%) 45 (44%) 34 (33%) 23 (23%) 12 (23%) 15 (28%) 26 (49%) 15 (28%) 20 (38%) 18 (34%) 43 (81%) 10 (19%) 17 (32%) 21 (40%) 15 (28%) 17 (35%) 13 (26%) 19 (39%) 26 (53%) 18 (37%) 5 (10%) 40 (82%) 9 (18%) 28 (57%) 13 (27%) 8 (16%) 2.3 Методы исследования Клинические и инструментальные методы Обязательными исследованими при установлении диагноза ХМЛ были: Жалобы, анамнез, объективный статус больного, размеры печени и селезенки (пальпаторно в сантиметрах от края реберной дуги); Клинический анализ крови с подсчетом лейкоцитарной формулы и определением уровня тромбоцитов; Биохимические показатели крови: общий билирубин, АСТ, АЛТ, ЛДГ, мочевая кислота, мочевина, креатинин, общий белок, альбумин, щелочная фосфатаза, электролиты (калий, натрий, кальций, фосфор, магний), амилаза, липаза, глюкоза, общий холестерин, липиды высокой и низкой плотности;

42 42 Морфологическое исследование пунктата костного мозга (миелограмма); Стандартное цитогенетическое исследование костного мозга: исследование не менее 20 метафаз, подтверждение наличия транслокации t(9;22)(q34;q11) (Ph-хромосомы). При неинформативности (нет митозов, неудовлетворительное качество материала) проводилось исследование костного мозга методом флуоресцентной гибридизации на стекле (FISH): выявление химерного гена BCR-ABL; При отсутствии стандартной Ph-хромосомы проводили исследование костного мозга методом FISH, для выявления «криптических» (скрытых) или вариантных транслокаций (химерного гена BCR-ABL), которые не могут быть выявлены стандартным цитогенетическим исследованием; Молекулярно-генетическое исследование периферической крови: определение экспрессии химерного транскрипта гена BCR-ABL p210 методом качественной и количественной полимеразной цепной реакции (ПЦР); При отсутствии типичного транскрипта гена BCR-ABL (р210) проводили определение редких транскриптов BCR-ABL (p190, р230) и других методом качественной или количественной ПЦР; Рентгенография органов грудной полости; Ультразвуковое исследование органов брюшной полости: печени, селезенки, размеров периферических лимфоузлов; Сбор информации о сопутствующих заболеваниях и сопутствующей терапии, при необходимости проводили дополнительное обследования.

43 Метод цитогенетического анализа Приготовление препаратов из суспензии клеток костного мозга включало следующие этапы: 1. Костный мозг в объеме 2-3 мл забирали в стандартную пробирку, содержащую ед. гепарина, перемешивали; 2. В 15 мл пробирке смешивали: 4,0 мл среды RPMI (с антибиотиком и глутамином), 1 мл сыворотки, костный мозг, (выдержая оптимальную концентрацию клеток на 1 мл среды RPMI), колцемид (в концентрации, рекомендованной производителем). Культивировали 24 часа при температуре +37ºС в закрытой системе; 3. Осаждали клетки центрифугированием при 1500 об/мин в течение 10 минут, супернатант удаляли пипеткой, оставляя 0,3-0,5 мл жидкости над осадком. Осадок разбивали энергичным встряхиванием и добавляли 8-10 мл гипотонического раствора (0,55% раствор KCl), перемешивали пипетированием и инкубировали 30 мин при +37ºС; 4. Для последующей фиксации осаждали клетки с помощью центрифугирования (10 мин, 1000 об/мин). Осадок тщательно разбивали встряхиванием в 0,5 мл надосадочной жидкости. К осадку добавляли 5 капель 5% уксусной кислоты, перемешивали, центрифугировали 10 минут. К осадку струйно приливали 8-10 мл холодного свежеприготовленного фиксатора (метанол + ледяная уксусная кислота в соотношении 3:1) и перемешивали пипетированием. Затем фиксатор меняли 2-3 раза, добавляя порции по 5-7 мл; 5. Раскапывание, полученной суспензии клеток проводили на обезжиренные предметные стекла, охлажденные в морозильной камере или в холодной воде, нанося на препарат с высоты см по мкл суспензии. Стекла обжигали над пламенем спиртовки и высушивали при комнатной температуре;

44 44 6. Далее проводили окраску с применением трипсина (GTG-техника). Обрабатывали стекло в 0,25% растворе трипсина (время подбиралось эмпирически в интервале сек.). Окрашивали 1 минуту в растворе красителя Гимза, разведенном на фосфатном буфере (ph = 6,8). Cмывали краситель проточной водой и высушивали. В каждом исследовании (в дебюте заболевания и на этапах мониторинга) было проанализировано не менее 20 метафазных пластин. Интерпретацию патологии кариотипа производили в соответствии с Международной номенклатурой дифференциально сегментированных хромосом [ISCN, 2013]. Для цитогенетического анализа и архивирования, полученных данных, использовали компьютерную систему анализа изображений «ВидеоТесТ». На рисунке 2.1 представлен результат цитогенетического исследования пациента. Рисунок 2.1 Кариограмма пациента с Ph-хромосомой, моносомией 7 хромосомы и дополнительным хромосомным материалом на q-плече 4 хромосомы, 45,XY,t(9;22)(q34;q11),add(4)(q35),-7,[20]

45 Метод флуоресцентной на стекле гибридизации (FISH) При невозможности проведения стандартного цитогенетического исследования (плохое качество материала, недостаточное количество, наличие атипичного транскрипта) выполняли исследование костного мозга методом флуоресцентной гибридизации на стекле. Для исследования применялась суспензия клеток костного мозга, разведенная в метанольно-уксусном фиксаторе и полученная для стандартного цитогенетического исследования или специально приготовленная (прямая культура). Предметное стекло с нанесенной суспензией исследуемых клеток высушивалось в горизонтальном положении. ДНК-зонд (LSI BCR-ABL (Dual Color, Dual Fusion, «Vysis») раскапывали на высушенные клетки и смесь покрывалась сверху покровным стеклом. Поверх покровного стекла обильно наносился резиновый клей, и предметное стекло помещалось в термобрайт «Abbot laboratories», где в автоматическом режиме последовательно осуществлялись процессы денатурации (при температуре 73 C в течение 3 мин.) и гибридзации (при температуре 37 C до 24 часов). При этом камера термобрайта была увлажнена. Через 24 часа, в предварительно разогретую водяную баню до 73 C, помещался стакан Коплина с раствором 0,4%ХSSC/0,3%NP-40. Предметное стекло извлекалось из термобрайта, с помощью пинцета поверхность его освобождалась от резинового клея и покровного стекла. Предметное стекло погружалось в горячий раствор 0,4%ХSSC/0,3%NP-40 на 2 минуты, после чего переносилось в стакан Коплина с раствором 2ХSSC/0,1%NP-40 комнатной температуры на 2 минуты. Далее, на высушенное при комнатной температуре в темном месте стекло, наносили 8-10 мкл разведенного DAPI и сверху прижимали содержимое покровным стеклом. Анализ и подсчет ядер производился при помощи люминесцентного микроскопа «Leica» DM1000. Интерпретация полученных результатов осуществлялась в соответствии с Международной

46 46 номенклатурой [ISCN, 2013]. Результат считался положительным в случае обнаружения двухцветного свечения nuc ish(abl1x3)(bcrx3)(abl1conbcrх2) и выражался в процентном соотношении проанализированных интерфазных ядер (рисунок 2.2). Анализу подвергалось не менее 200 клеток. Рисунок 2.2 Результат FISH-исследования костного мозга больного ХМЛ с обнаруженным свечением nuc ish(abl1x3)(bcrx3)(abl1conbcrх2) в результате образования химерного гена BCR-ABL Метод качественного определения химерного гена BCR-ABL Исследование наличия транслокаций t(9;22)(q34;q11) с образованием химерного гена BCR-ABL, у больных ХМЛ проводили методом обратнотранскриптазной полимеразной цепной реакции (ОТ-ПЦР) на РНК из клеток периферической крови или костного мозга, забранных в вакуумные пробирки с ЭДТА и стабилизированных РНК средой. Выделение РНК из клеток крови или костного мозга проводили согласно инструкции к набору (АмплиСенс Лейкоз Квант M-bcr-FRT; ИнтерЛабСервис, Россия). Высушенный осадок РНК растворяли в 40мкл ddh 2 O. Раствор РНК подлежит хранению при 80ºС. Для проведения обратной транскрипции к 10 мкл раствора РНК добавляли 1 мкл oligodt и 0,8 мкл гексамеров Н6 (Beagle, Россия). Пробирки со смесью помещали в амплификатор (CFX, BIORAD, США) и инкубировали при температуре 65ºС 5 мин. Затем в подготовленные таким образом пробы добавляли

47 47 реакционную смесь, состоящую из буфера для ревертазы, смеси dntp, ревертазы и ингибитора обратной транскриптазы в соответствии с инструкцией к набору для проведения обратной транскрипции (ОТ) (Fermentas, США). ОТ проводили по схеме: 25ºС 10 мин., 43ºС 60 мин., 70ºС 10 мин (CFX, BIORAD, США). Полученная кднк подлежит хранению при 80ºС. Для проведения ПЦР готовили смесь состава: ddh2o 12,2 мкл, 10-кратный ПЦР-буфер (Beagle, Россия) 2 мкл, dntp 2,5 мм (Синтол, Россия) 2 мкл, Taqполимераза (ИнтерЛабСервис, Россия) 0,4 мкл, смесь прямого и обратного праймеров для специфичной амплификации химерного гена (10 пмоль/мкл) (Beagle, Россия) 0,6 мкл. Также для каждого образца готовили контрольную пробу с праймерами к фрагменту гена ABL. Количество кднк на реакцию 3 мкл. Амплификацию проводили по схеме: 95ºС 5 мин., 35 циклов: 95ºС 30 сек., 69ºС 30 сек., 72ºС 30 сек. (Терцик, ДНК-технология, Россия) (таблица 2.6). Полученные ПЦР-продукты анализировали в 6% полиакриламидном геле. Для этого в лунки геля помещали по 10 мкл амплификата, в одну из лунок наносили маркер молекулярного веса (ДНК фага λ ферментно-гидролизованная). Электрофорез вели в 0,5-кратном растворе трис-фосфатного буфера при 170В первые 10 мин., затем при 200В до выхода бромфенолового синего из геля. Далее гель окрашивали в течение 2-3 минут в растворе бромистого этидия (20 мкл на 400 мл) (Хеликон, Россия), промывали в дистиллированной воде и анализировали на трансиллюминаторе с помощью видеосистемы DocPrint (VilberLourmat, Франция). Результат анализа для данного химерного гена считался отрицательным (транслокации нет), если на соответствующей дорожке геля отсутствовали бенды, характерные для данной транслокации, а на дорожке с контрольным фрагментом гена ABL был виден ПЦР-продукт. Если бенд для гена ABL отсутствовал, результаты признавали недействительными (рисунки 2.3, 2.4, 2.5).

48 48 Таблица 2.6 Нуклеотидные последовательности праймеров, используемых для амплификации фрагментов гена BCR-ABL Химерный ген t(9;22)(q34;q11) BCR-ABL p190 t(9;22)(q34;q11) BCR-ABL p210 Последовательность праймеров AB BCR-e1-A GACTGCAGCTCCAATGAGAAC ABL-a3-B GTTTGGGCTTCACACCAATTCC BCR-b1-A GAAGTGTTTCAGAAGCTTCTCC ABL-a3-B GTTTGGGCTTCACACCAATTCC Последовательность праймеров CD BCR-e1-C CAGAACTCGCAACAGTCCTTC ABL-a3-D TTCCCCATTGTGATTATAGCCTA BCR-b2-C CAGATGCTGACCAACTCGTGT ABL-a3-D TTCCCCATTGTGATTATAGCCTA Варианты ПЦР продуктов и их размер после двух рандов ПЦР и частота обнаружения p190 e1-a2 381 п.о. (>95%) p190 e1-a3 207 п.о. (редко) p210 b3-a2 360 п.о. (~55%) p210 b2-a2 285 п.о. (~40%) p210 b3-a3 186 п.о. (редко) p210 b2-a3 111 п.о. (редко) 1 дорожка положительный образец 2 отрицательный образец 3 контрольный образец ABL 4 образец с коэкспрессией белков р190 и р210 5 маркер молекулярного веса λ Рисунок 2.3 Электрофореграмма продуктов амплификации гена BCR-ABL (белок р190)

49 49 1 дорожка положительный образец (коэкспрессия вариантов b2a2 и b3a2) 2 отрицательный образец 3 контрольный образец ABL 4 положительный образец (вариант b2a2) 5 маркер молекулярного веса λ Рисунок 2.4 Электрофореграмма продуктов амплификации гена BCR-ABL (белок р210) 1,2,3,7 дорожки положительные образцы (вариант b3a2) 4 маркер молекулярного веса λ 5 положительный образец (вариант b2a2) 6 отрицательный образец Рисунок 2.5 Электрофореграмма продуктов амплификации гена BCR-ABL (белок р210)

50 50 Результат анализа для данного химерного гена считался положительным (транслокация есть), если на соответствующей дорожке геля наблюдали бенды ПЦР-продукта определенного размера относительно маркерных бендов, а на дорожке с контрольным фрагментом гена ABL присутствовал ПЦР-продукт. Если бенд для гена ABL отсутствовал, проводили повторную амплификацию для ABL. В случае повторного отрицательного результата для ABL результаты признавали недействительными Метод количественного определения экспрессии гена BCR-ABL Количественное определение экспрессии химерного гена BCR-ABL проводили методом ПЦР с гибридизационно-флуоресцентной детекцией в режиме «реального времени» на наборах АмплиСенс Лейкоз Квант M-bcr-FRT (ИнтерЛабСервис, Россия), согласно инструкции производителя. Методика исследования включала следующие этапы: 1. экстракции тотальной РНК из клеток периферической крови; 2. проведении реакции обратной транскрипции; 3. амплификация в режиме «реального времени» с двумя смесями олигонуклеотидов (ПЦР-смесь-1-FRT M-BCR-ABL и ПЦР-смесь-1- FRT N-BAL для BCR-ABL и ABL соответственно). Регистрация результатов осуществлялась по каналу флуоресценции HEX [124]. Анализ кривых накопления флуоресцентного сигнала проводили с помощью программного обеспечения Bio-Rad iq5 в соответствии с инструкцией к прибору. Для каждого образца регистрировали накопление продукта амплификации участка кднк M-BCR-ABL и гена-нормализатора/внутреннего контроля ABL. Полученные значения использовали для расчета нормализованной концентрации РНК M-BCR-ABL в исследуемых и контрольных образцах по следующей схеме: 1. для всех образцов рассчитывали отношение M-BCR-ABL/ABL: Число копий кднк M-BCR-ABL / число копий кднк N-ABL

51 51 2. рассчитывали среднее значение отношения концентраций M-BCR- ABL/ABL для двух повторов образца. Результаты оценивали с последующей коррекцией полученных значений BCR-ABL/ABL в % по международной шкале (IS) с использованием фактора конверсии [70]. По результатам международной стандартизации фактор конверсии лаборатории равен 1,236. Глубину ответов определяли следующим образом: БМО (МО 3,0 ) BCR-ABL/ABL 0,1% и >0,01% по международной шкале (IS); МО 4,0 BCR-ABL/ABL 0,01 и >0,0032% (IS) или неопределяемый уровень BCR-ABL при количестве ABL 1,0х10 4 ; МО 4,5 BCR-ABL/ABL 0,0032% и >0,001% (IS) или неопределяемый уровень BCR-ABL при количестве ABL 3,2х10 4 ; МО 5,0 BCR-ABL/ABL 0,001% (IS) или неопределяемый уровень BCR-ABL при количестве ABL 1,0х Метод анализа мутационного статуса гена BCR-ABL Выявление мутаций в киназном домене гена BCR-ABL проводили методом прямого секвенирования по Сэнгеру [136, 137]. Использованная методика подходит только для анализа следующих вариантов транскриптов b2a2, b2a3, b3a2, b3a3 с относительным уровнем экспрессии химерного гена BCR-ABL не менее 2%. 1. Амплификацию интересующего фрагмента гена BCR-ABL осуществляли в два этапа: в реакционную смесь состава 4,2 мкл ddh2o, 6 мкл 2,5-кратного реакционного буфера (Синтол, Россия), 0,6 мкл 25мМ MgCl2 (Синтол, Россия), 0,6 мкл каждого праймера В2А-F (5 - TTCAGAAGCTTCTCCCTGACAT-3 ) и 4065-R (5 - CCTTCTCTAGCAGCTCATACACCTG-3 ) (10 пмоль/мкл) добавляли

52 52 3 мкл кднк, полученной как указано в п ПЦР проводили по схеме: 95ºС 10 мин., 40 циклов: 95ºС 30 сек., 60ºС 30 сек., 72ºС 1 мин., завершающая элонгация 72ºС 10 мин. (Терцик, ДНКтехнология, Россия); 3 мкл полученного ПЦР-продукта использовали в качестве матрицы во втором раунде амплификации с праймерами 3306-F (5 - TGGTTCATCATCATTCAACGG-3 ) и 4000-R (5 - GGACATGCCATAGGTAGCA-3 ) (10 пмоль/мкл). Объем смеси при этом был увеличен до 50 мкл пропорциональным увеличением объемов компонентов, описанных в п.1. Был использован следующий режим ПЦР: 95ºС 10 мин., 40 циклов: 95ºС 30 сек., 60ºС 30 сек., 72ºС 1 мин. 30 сек, завершающая элонгация 72ºС 10 мин. (Терцик, ДНК-технология, Россия); далее проводили визуальную оценку качества продуктов амплификации в 6% ПААГ, как описано в п При наличии на электрофореграмме отчетливо видимого бенда, соответствующего длине 622 п.н., отправляли образец на секвенирование. 2. Секвенирование образцов проводили на автоматической капиллярной системе MegaBACE 1000 DNA Analysis System (Amersham Biosciences, Великобритания) с использованием набора реагентов DYEnamic ET dye terminator cycle sequencing kit. Продукты ПЦР были предварительно очищены от несвязавшихся dntp согласно протоколам, рекомендованным фирмой-производителем при помощи буфера (0,15M NH 4 COOH, 95% C 2 H 5 OH). Далее к 20 нг очищенного ПЦР-продукта добавляли реакционную смесь (8 мкл Terminator Mix (1000 мm dntp и 5 мm ddntp), 10 пкмоль праймера 3306-F или 4000-R, деионизированная вода до объема 20 мкл). Температурные условия реакции были следующими: начальная денатурация 96 С 1 мин; 27 циклов в режиме 96 С 10 сек, 60 С 5 сек, 65 С 4 мин. Затем продукты ПЦР были снова очищены, растворены в 12 мкл формамида и помещены в анализатор. Анализ последовательностей проводили с

53 53 помощью программ VECTOR NTI и Sequence Scanner 2.0 (рисунок 2.6, 2.7, 2.8). Рисунок 2.6 Фрагмент последовательности с выявленной мутацией T315I Рисунок 2.7 Фрагмент последовательности с выявленной мутацией M244V Рисунок 2.8 Замена A/G, приводящая к мутации G250E


Шухов Олег Александрович

Шухов Олег Александрович Федеральное государственное бюджетное учреждение «Гематологический научный центр Министерства здравоохранения Российской Федерации» На правах рукописи Шухов Олег Александрович «Молекулярная и цитогенетическая

Подробнее

государственного бюджетного учреждения «Российский научноисследовательский

государственного бюджетного учреждения «Российский научноисследовательский ЗАКЛЮЧЕНИЕ ДИССЕРТАЦИОННОГО СОВЕТА Д 208.074.01 НА БАЗЕ ФЕДЕРАЛЬНОГО ГОСУДАРСТВЕННОГО БЮДЖЕТНОГО УЧРЕЖДЕНИЯ «РОССИЙСКИЙ НАУЧНО-ИССЛЕДОВАТЕЛЬСКИЙ ИНСТИТУТ ГЕМАТОЛОГИИ И ТРАНСФУЗИОЛОГИИ ФЕДЕРАЛЬНОГО МЕДИКО-

Подробнее

Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ. ЗАО «БиоХимМак»

Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ. ЗАО «БиоХимМак» Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ ЗАО «БиоХимМак» Хронический миелолейкоз (ХМЛ) Филадельфийская хромосома представляет собой генетическую аномалию,

Подробнее

Клинические рекомендации по диагностике и лечению хронического миелолейкоза

Клинические рекомендации по диагностике и лечению хронического миелолейкоза Клинические рекомендации по диагностике и лечению хронического миелолейкоза Коллектив авторов под руководством академика Савченко В.Г.: А.Г.Туркина 1, А.Ю. Зарицкий. 2, В.А. Шуваев 3, Е.Ю Челышева. 1,

Подробнее

Актуальность темы исследования Степень обоснованности научных положений, выводов и рекомендаций Новизна научных положений, выводов и рекомендаций

Актуальность темы исследования Степень обоснованности научных положений, выводов и рекомендаций Новизна научных положений, выводов и рекомендаций отзыв официального оппонента на диссертационную работу Немченко Ирины Семеновны на тему «Миелопролиферативные заболевания, протекающие с эозинофилией: клиника, диагностика, лечение», представленную на

Подробнее

Рекомендации по лечению пациентов с ХМЛ

Рекомендации по лечению пациентов с ХМЛ Рекомендации по лечению пациентов с ХМЛ Адаптированное для пациентов обобщение рекомендаций по лечению хронического миелоидного лейкоза, разработанных Европейской организацией European LeukemiaNet в 2013

Подробнее

Оглавление. Медицинская методология ДЗМ ММ - С 92.1 v1-2017

Оглавление. Медицинская методология ДЗМ ММ - С 92.1 v1-2017 5 Оглавление Глава 1. Термины и определения... 8 Глава 2. Лечебно-диагностический алгоритм... 9 Общие положения... 9 Прогноз... 9 Распространенность и заболеваемость... 10 Основные факторы риска... 10

Подробнее

ОПРЕДЕЛЕНИЕ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ РЕЦИДИВА ОСТРОГО ЛИМФОБЛАСТНОГО ЛЕЙКОЗА У ДЕТЕЙ. Инструкция по применению

ОПРЕДЕЛЕНИЕ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ РЕЦИДИВА ОСТРОГО ЛИМФОБЛАСТНОГО ЛЕЙКОЗА У ДЕТЕЙ. Инструкция по применению МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра здравоохранения В.В. Колбанов 23 октября 2006 г. Регистрационный 1701205 ОПРЕДЕЛЕНИЕ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ РЕЦИДИВА

Подробнее

Организация терапии хронического миелолейкоза. Первый. общероссийский регистр больных хроническим миелолейкозом: анализ и

Организация терапии хронического миелолейкоза. Первый. общероссийский регистр больных хроническим миелолейкозом: анализ и Организация терапии хронического миелолейкоза. Первый общероссийский регистр больных хроническим миелолейкозом: анализ и перспективы О. Ю. Виноградова, А. Г. Туркина, Н. Д. Хорошко Гематологический научный

Подробнее

ЭТИОЛОГИЯ: ОПРЕДЕЛЕНИЕ: ФАЗЫ ЗАБОЛЕВАНИЯ: ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ

ЭТИОЛОГИЯ: ОПРЕДЕЛЕНИЕ: ФАЗЫ ЗАБОЛЕВАНИЯ: ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ ОПРЕДЕЛЕНИЕ: ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ - МИЕЛОПРОЛИФЕРАТИВНОЕ ЗАБОЛЕВАНИЕ ИЗ ГРУППЫ ХРОНИЧЕСКИХ ЛЕЙКОЗОВ (ЗЛОКАЧЕСТВЕННОЕ ЗАБОЛЕВАНИЕ ГЕМОПОЭТИЧЕСКОЙ ТКАНИ), ХАРАКТЕРИЗУЮЩЕЕСЯ КЛОНАЛЬНЫМ

Подробнее

ОНКОГЕМАТОЛОГИЯ. Материалы 55-го конгресса Американского гематологического общества (декабрь 2013 г., Новый Орлеан) ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ

ОНКОГЕМАТОЛОГИЯ. Материалы 55-го конгресса Американского гематологического общества (декабрь 2013 г., Новый Орлеан) ХРОНИЧЕСКИЙ МИЕЛОЛЕЙКОЗ ТОМ 7 НОМЕР 2 2014 КЛИНИЧЕСКАЯ ОНКОГЕМАТОЛОГИЯ СЪЕЗДЫ, КОНФЕРЕНЦИИ, СИМПОЗИУМЫ Материалы 55-го конгресса Американского гематологического общества (декабрь 2013 г., Новый Орлеан) С 7 по 10 декабря 2013

Подробнее

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА Национальное гематологическое общество КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА Рекомендации утверждены на II Конгрессе гематологов России (апрель 2014г) 2014 г. 2 Коллектив

Подробнее

å ÚÂappleË Î ÒËÏÔÓÁËÛÏ

å ÚÂappleË Î ÒËÏÔÓÁËÛÏ ëó appleâïâìì fl éìíóîó Ëfl å ÚÂappleË Î ÒËÏÔÓÁËÛÏ Хронический миелолейкоз: принять решение. Вклад таргетной терапии в лечение ХМЛ M.Copeman 3 ХМЛ: оптимизация дозы иматиниба проф. А.Ю.Зарицкий 7 Мониторинг

Подробнее

Докладчик главный врач Орлова Наталья Ивановна

Докладчик главный врач Орлова Наталья Ивановна Опыт централизации лабораторных исследований при онкогематологической патологии на базе бюджетного учреждения здравоохранения Омской области «Клинический диагностический центр». Комплексный подход к диагностике

Подробнее

На правах рукописи. Шухов Олег Александрович

На правах рукописи. Шухов Олег Александрович На правах рукописи Шухов Олег Александрович «Молекулярная и цитогенетическая характеристика Ph-позитивного клона у больных хроническим миелолейкозом при длительном воздействии ингибиторов тирозинкиназ»

Подробнее

Clinical Recommendations for the Diagnosis and Treatment of Chronic Myeloid Leukemia

Clinical Recommendations for the Diagnosis and Treatment of Chronic Myeloid Leukemia Клиническая онкогематология. 2017;10(3):294 316 Clinical oncohematology. 2017;10(3):294 316 КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ CLINICAL GUIDELINES Клинические рекомендации по диагностике и лечению хронического миелолейкоза

Подробнее

Раздел I ХРОНИЧЕСКИЕ МИЕЛОПРОЛИФЕРАТИВНЫЕ ЗАБОЛЕВАНИЯ

Раздел I ХРОНИЧЕСКИЕ МИЕЛОПРОЛИФЕРАТИВНЫЕ ЗАБОЛЕВАНИЯ Раздел I ХРОНИЧЕСКИЕ МИЕЛОПРОЛИФЕРАТИВНЫЕ ЗАБОЛЕВАНИЯ А. Г. Туркина, Е. Ю. Челышева, Г. А. Гусарова, О. Ю. Виноградова, О. В. Лазарева, С. В. Кузнецов, Н. Д. Хорошко Руководитель протокола Координаторы

Подробнее

1 Федеральное государственное бюджетное учреждение «Гематологический Научный Центр» Министерства здравоохранения Российской Федерации

1 Федеральное государственное бюджетное учреждение «Гематологический Научный Центр» Министерства здравоохранения Российской Федерации 1 Федеральное государственное бюджетное учреждение «Гематологический Научный Центр» Министерства здравоохранения Российской Федерации Федеральное государственное бюджетное учреждение «Российский научноисследовательский

Подробнее

Отзыв. Актуальность темы

Отзыв. Актуальность темы Отзыв официального оппонента - доктора медицинских наук, старшего научного сотрудника отделения клинической гематологии и иммунотерапии государственного бюджетного учреждения здравоохранения Московской

Подробнее

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА

КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА Национальное гематологическое общество КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА Вторая редакция На основании консенсуса специалистов от 5 ноября 2014 г. 2 Коллектив авторов

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ГОСУДАРСТВЕННОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ГОСУДАРСТВЕННОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ГОСУДАРСТВЕННОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ «РОССИЙСКИЙ НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ ИМЕНИ

Подробнее

СОДЕРЖАНИЕ том 1 номер 3 июль сентябрь 2008

СОДЕРЖАНИЕ том 1 номер 3 июль сентябрь 2008 КЛИНИЧЕСКАЯ ОНКОГЕМАТОЛОГИЯ СОДЕРЖАНИЕ том 1 номер 3 июль сентябрь 2008 Биология гемобластозов Значение анализа мутаций гена BCR-ABL в оптимизации таргетной терапии хронического м иелолейкоза...190 Куцев

Подробнее

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА доктора медицинских наук Проценко Светланы Анатольевны

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА доктора медицинских наук Проценко Светланы Анатольевны ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА доктора медицинских наук Проценко Светланы Анатольевны на диссертационную работу Моисеенко Владислава Евгеньевича на тему: «Обоснование периоперационной регионарной химиотерапии

Подробнее

Материалы 59-го конгресса Американского гематологического общества (декабрь 2017 г., Атланта)

Материалы 59-го конгресса Американского гематологического общества (декабрь 2017 г., Атланта) Клиническая онкогематология. 218;11(2):198 27 Clinical oncohematology. 218;11(2):198 27 СЪЕЗДЫ, КОНФЕРЕНЦИИ, СИМПОЗИУМЫ CONGRESSES, CONFERENCES, SYMPOSIA Материалы 59-го конгресса Американского гематологического

Подробнее

Протокол клинической апробации метода профилактики, лечения, диагностики и реабилитации. Идентификационный Дата

Протокол клинической апробации метода профилактики, лечения, диагностики и реабилитации. Идентификационный Дата 3 Протокол клинической апробации метода профилактики, лечения, диагностики и реабилитации Идентификационный Дата 17.08.2015 I. Паспортная часть 1. Название апробируемого метода профилактики, диагностики,

Подробнее

Достоверность и обоснованность результатов, выводов и рекомендаций

Достоверность и обоснованность результатов, выводов и рекомендаций ОТЗЫВ официального оппонента на диссертационную работу Смолькова Ивана Владимировича «Иммуногенетические механизмы развития ишемического инсульта мозга», представленную на соискание ученой степени кандидата

Подробнее

Р А С П О Р Я Ж Е Н И Е

Р А С П О Р Я Ж Е Н И Е Д Е П А Р Т А М Е Н Т З Д Р А В О О Х Р А Н Е Н И Я К И Р О В С К О Й О Б Л А С Т И Р А С П О Р Я Ж Е Н И Е от 01.06.2015 467 г. Киров О внесении изменений в распоряжение департамента здравоохранения Кировской

Подробнее

Хронический миелолейкоз: клинические рекомендации ESMO (Европейского общества Клинической Онкологии) по диагностике, лечению и наблюдению.

Хронический миелолейкоз: клинические рекомендации ESMO (Европейского общества Клинической Онкологии) по диагностике, лечению и наблюдению. Annals of Oncology 19 (suppl 2): ii63-64, 2008 Хронический миелолейкоз: клинические рекомендации ESMO (Европейского общества Клинической Онкологии) по диагностике, лечению и наблюдению. Chronic myelogeneous

Подробнее

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕЧЕНИЮ АНЕМИИ У БОЛЬНЫХ ЗЛОКАЧЕСТВЕННЫМИ НОВООБРАЗОВАНИЯМИ

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕЧЕНИЮ АНЕМИИ У БОЛЬНЫХ ЗЛОКАЧЕСТВЕННЫМИ НОВООБРАЗОВАНИЯМИ Проект рабочей группы RUSSCO по поддерживающей терапии: индивидуализация поддерживающей терапии (коррекция анемии, нейтропении и назначение остеомодифицирующих агентов) ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕЧЕНИЮ

Подробнее

Вступительное слово Рекомендации по терапии ХМЛ: Настоящее и Интерактивная сессия

Вступительное слово Рекомендации по терапии ХМЛ: Настоящее и Интерактивная сессия Хронический миелолейкоз настоящее и будущее 9 00-9 10 Вступительное слово Всероссийская научно-практическая конференция Хронические лейкозы Современные методы диагностики и лечения 15-16 мая 2015 ФГБУ

Подробнее

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕКАРСТВЕННОМУ ЛЕЧЕНИЮ БОЛЬНЫХ ГАСТРОИНТЕСТИНАЛЬНЫМИ СТРОМАЛЬНЫМИ ОПУХОЛЯМИ (GIST)

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕКАРСТВЕННОМУ ЛЕЧЕНИЮ БОЛЬНЫХ ГАСТРОИНТЕСТИНАЛЬНЫМИ СТРОМАЛЬНЫМИ ОПУХОЛЯМИ (GIST) 260 ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ. Версия 2014 ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ЛЕКАРСТВЕННОМУ ЛЕЧЕНИЮ БОЛЬНЫХ ГАСТРОИНТЕСТИНАЛЬНЫМИ СТРОМАЛЬНЫМИ ОПУХОЛЯМИ (GIST) ДИАГНОСТИКА Диагноз устанавливается на основании:

Подробнее

Актуальность работы обусловлена высокой частотой встречаемости В. линейных гематологических опухолей. Острый лимфобластный лейкоз (ОЛЛ)

Актуальность работы обусловлена высокой частотой встречаемости В. линейных гематологических опухолей. Острый лимфобластный лейкоз (ОЛЛ) отзыв официального оппонента, доктора медицинских наук, профессора Гариба ФИруза Юсуиовича на диссертационную работу Образцова Игоря Владимировича «Клиническое значение определения наивных Т- и В-клеток

Подробнее

Достоверность и новизна основных выводов диссертации.

Достоверность и новизна основных выводов диссертации. Отзыв Официального оппонента доктора медицинских наук Ульрих Елены Александровны на диссертационную работу Васильева Андрея Николаевича на тему: «Интегриновые рецепторы и белки внеклеточного матрикса при

Подробнее

Профиль медицинской помощи в рамках которого запланировано проведение научного исследования

Профиль медицинской помощи в рамках которого запланировано проведение научного исследования Разработка и внедрение новых молекулярно-генетических и протеомных подходов для диагностики первичных и вторичных кардиомиопатий с целью подбора персонифицированной терапии и прогнозирования. Актуальность

Подробнее

отзьm официальиого оппонента

отзьm официальиого оппонента отзьm официальиого оппонента на диссертацию Матвея Михайловича Цыганова «Изучение связи генетического полиморфизма с экспрессией АВС-транспортеров в опухоли молочной железы при химиотерапии», представленную

Подробнее

Глава X. Приложение (базовая информация и подробности).

Глава X. Приложение (базовая информация и подробности). Глава X. Приложение (базовая информация и подробности). 1. К Главе I, относящейся к общим введениям. Базовая информация: Хромосомные аберрации при острых лейкемиях (p6). Хромосомные аберрации при острых

Подробнее

Использование антигенов поверхностной мембраны клеток крови для иммунофенотипической диагностики гематологических заболеваний.

Использование антигенов поверхностной мембраны клеток крови для иммунофенотипической диагностики гематологических заболеваний. 1.2.5. Использование антигенов поверхностной мембраны клеток крови для иммунофенотипической диагностики гематологических заболеваний. Возможности ИФТ в прогнозировании течения и исхода онкогематологических

Подробнее

Научная новизна диссертационного исследования

Научная новизна диссертационного исследования неспецифических иммуносупрессивных препаратов, главным образом, цитостатиков и кортикостероидов, имеющих большое количество побочных эффектов и негативно влияющих на организм ребенка в период его интенсивного

Подробнее

отзыв в е д у щ е й о р г а н и з а ц и и

отзыв в е д у щ е й о р г а н и з а ц и и отзыв в е д у щ е й о р г а н и з а ц и и Федеральное государственное бюджетное учреждение «Российский онкологический научный центр имени Н.Н. Блохина» Министерства здравоохранения Российской Федерации

Подробнее

СПОСОБ ЛЕЧЕНИЯ АГРЕССИВНЫХ НЕХОДЖКИНСКИХ ЛИМФОМ I, II, III, IV СТАДИЙ

СПОСОБ ЛЕЧЕНИЯ АГРЕССИВНЫХ НЕХОДЖКИНСКИХ ЛИМФОМ I, II, III, IV СТАДИЙ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра 11 апреля 2003 г. Регистрационный 174 1202 В.В. Колбанов СПОСОБ ЛЕЧЕНИЯ АГРЕССИВНЫХ НЕХОДЖКИНСКИХ ЛИМФОМ I, II, III,

Подробнее

Деметилирование ДНК в лечении детей c острыми миелоидными лейкозами

Деметилирование ДНК в лечении детей c острыми миелоидными лейкозами Деметилирование ДНК в лечении детей c острыми миелоидными лейкозами Немировченко В.С., Флейшман Е.В, Серебрякова И.Н., Сокова О.И., Курдюков Б.В., Попа А.В. Октябрь 2006 по февраль 2012гг. протокол НИИ

Подробнее

Целью представленной диссертационной работы явилось определение алгоритма ранней диагностики БП на основании изучения и

Целью представленной диссертационной работы явилось определение алгоритма ранней диагностики БП на основании изучения и ОТЗЫВ на диссертационную работу Хасановой Д.М. «Клинические проявления и показатели катехоламинового обмена в диагностике начальных стадий болезни Паркинсона», представленную на соискание ученой степени

Подробнее

ЗАКЛЮЧЕНИЕ ПРЕДВАРИТЕЛЬНОЙ ЭКСПЕРТИЗЫ

ЗАКЛЮЧЕНИЕ ПРЕДВАРИТЕЛЬНОЙ ЭКСПЕРТИЗЫ ЗАКЛЮЧЕНИЕ ПРЕДВАРИТЕЛЬНОЙ ЭКСПЕРТИЗЫ комиссии Диссертационного Совета Д 001.016.01 при Федеральном государственном бюджетном научном учреждении «Медикогенетический научный центр» (ФГБНУ «МГНЦ») от 01.07.2015

Подробнее

Глава VI. B-клеточны е неоплазии.

Глава VI. B-клеточны е неоплазии. Глава VI. B-клеточны е неоплазии. 1. Неоплазии B-клеточных предшественников. 2. Неоплазии зрелых B-клеток. 3. В-клеточные пролиферативные процессы с неясным потенциалом злокачественности. 1. Неоплазии

Подробнее

«[}3» ---,---!_:.< :: г.

«[}3» ---,---!_:.< :: г. «УТВЕРЖДАЮ» Проректор по научной работе ФГБОУ ВО «Московский государственный медико-стоматологический университет им. А.И. Евдокимова» Минздрава России, к.и.н. Е.А. Вольская «[}3» ---,---!_:.< ::... 2018

Подробнее

д.м.н., проф. В.А. ГорбуноВА, д.б.н. н.н. МАЗурЕнко, к.м.н. и.м. ГАГАрин, к.м.н. А.А. коломейцева, В.В. МочАльникоВА

д.м.н., проф. В.А. ГорбуноВА, д.б.н. н.н. МАЗурЕнко, к.м.н. и.м. ГАГАрин, к.м.н. А.А. коломейцева, В.В. МочАльникоВА ФГБУ «РОНЦ им. Н.Н. Блохина» РАМН Мутации рецептора эпидермального фактора роста (EGFR) как показатель эффективности ингибиторов тирозинкиназ у больных немелкоклеточным раком легкого (нмрл)* д.м.н., проф.

Подробнее

ФЕДЕРАЛЬНЫЕ КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА

ФЕДЕРАЛЬНЫЕ КЛИНИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ДИАГНОСТИКЕ И ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОЛЕЙКОЗА ВЕСТНИК ГЕМАТОЛОГИИ, том IX, 3, 2013 Абдулкадыров К. М. 1, Абдуллаев А. О. 2, Авдеева Л. Б. 3, Афанасьев Б. В. 4, Виноградова Е. Ю. 5, Виноградова О. Ю. 2, Волкова С. А. 6, Глонина Н. Н. 7, Глыжина Е.

Подробнее

Глава 2. Материалы и методы Пациенты.

Глава 2. Материалы и методы Пациенты. Глава 2. Материалы и методы. 2.1. Пациенты. У всех пациентов, доноров и родителей детей до 15 лет было получено информированное согласие на участие в исследовании. В исследование включены данные по 281

Подробнее

официального оппонента доктора медицинских наук, профессора, Аршинова Андрея Владимировича

официального оппонента доктора медицинских наук, профессора, Аршинова Андрея Владимировича отзыв официального оппонента доктора медицинских наук, профессора, Аршинова Андрея Владимировича на диссертационную работу Меснянкиной Анны Александровны «Динамика субпопуляций В- лимфоцитов у пациентов

Подробнее

профессионального образования «Смоленская государственная медицинская академия» Министерства здравоохранения Российской Федерации.

профессионального образования «Смоленская государственная медицинская академия» Министерства здравоохранения Российской Федерации. профессионального образования «Смоленская государственная медицинская академия» Министерства здравоохранения Российской Федерации. Научный руководитель: Маслова Наталья Николаевна профессор, доктор медицинских

Подробнее

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ Государственное бюд жетное образовательное учреждение высшего профессионального образования «Уральский государственный Медицинский университет» Министерства здравоохранения Российской Федерации» (ГБОУ

Подробнее

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА заведующей кафедрой реабилитологии ФП и ДПО ФГБОУ ВО «Санкт- Петербургский государственный педиатрический медицинский университет», доктора медицинских наук, профессора СУСЛОВОЙ

Подробнее

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ УТВЕРЖДАЮ Проректор по научной работе ГБОУ ВПО Московский государственный югический университет Минздрава России Вольская Е.А. 2015 г. ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ о научно-практической значимости кандидатской

Подробнее

Актуальность темы. Достоверность и новизна результатов диссертации.

Актуальность темы. Достоверность и новизна результатов диссертации. отзыв доктора медицинских наук, профессора, заведующего кафедрой поликлинической терапии лечебного факультета ФГБОУ ВО «Первый Московский государственный медицинский университет им. И.М. Сеченова» Министерства

Подробнее

Новизна исследования и полученных результатов, выводов и рекомендаций, сформулированных в диссертации

Новизна исследования и полученных результатов, выводов и рекомендаций, сформулированных в диссертации 2 значительные успехи современной медицины в оказании высокотехнологичной кардиохирургической помощи, ишемическая болезнь сердца (ИБС) продолжает оставаться одной из ведущих причин инвалидизации и смертности

Подробнее

ОТЗЫВ Актуальность темы выполненной работы.

ОТЗЫВ Актуальность темы выполненной работы. ОТЗЫВ официального оппонента Асанова Алия Юрьевича на диссертационную работу Цуканова Алексея Сергеевича на тему: «Стратегия комплексного молекулярногенетического изучения наследственных форм колоректального

Подробнее

УТВЕРЖДАЮ Заместитель начальника Военно-медицинской академии имени*с/.м. Кирова по учащей: инауцнрй работе. Б.Н. Котив ^ г.

УТВЕРЖДАЮ Заместитель начальника Военно-медицинской академии имени*с/.м. Кирова по учащей: инауцнрй работе. Б.Н. Котив ^ г. МИНИСТЕРСТВО ОБОРОНЫ РОССИЙСКОЙ ФЕДЕРАЦИИ (МИНОБОРОНЫ РОССИИ) ВОЕННО-МЕДИЦИНСКАЯ АКАДЕМИЯ г. Санкт-Петербург, ул. Академика Лебедева, 6, 1S УТВЕРЖДАЮ Заместитель начальника Военно-медицинской академии

Подробнее

4. Острая миелоидная лейкемия, неклассифицированная.

4. Острая миелоидная лейкемия, неклассифицированная. 4. Острая миелоидная лейкемия, неклассифицированная. 1) ОМЛ, минимально дифференцированная (M0). 2) ОМЛ без дозревания (M1). 3) ОМЛ без дозревания (M2). 4) Острая миеломоноцитарная лейкемия (M4). 5) Острая

Подробнее

«УТВЕРЖДАЮ» Проректор по научной работе РНИМУ. у. им. Н.И. Пирогова Минздрава России П (. - V '... ; I-. ' ' Д.В. Ребриков г.

«УТВЕРЖДАЮ» Проректор по научной работе РНИМУ. у. им. Н.И. Пирогова Минздрава России П (. - V '... ; I-. ' ' Д.В. Ребриков г. Министерство здравоохранения Российской Федерации Государственное бюджетное образовательное учреждение высшего профессионального образования «Российский национальный исследовательский медицинский университет

Подробнее

Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия

Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия Исследование аспирата Забор в пробирку с ЭДТА 2 мл Приготовление мазков, подсчет

Подробнее

Актуальность темы диссертационной работы

Актуальность темы диссертационной работы отзыв официального оппонента, доктора медицинских наук, профессора Марцевича Сергея Юрьевича на диссертационную работу Солодун Марии Валерьевны «Клинико-прогностическое значение полиморфизма некоторых

Подробнее

Актуальность темы исследования

Актуальность темы исследования отзыв официального оппонента, доктора медицинских наук, профессора Заводовского Бориса Валерьевича на диссертационную работу Румянцевой Дарьи Гаврильевны на тему «Ранний аксиальный спондилоартрит: особенности

Подробнее

«УТВЕРЖДАЮ» Проректор по научной работе

«УТВЕРЖДАЮ» Проректор по научной работе «УТВЕРЖДАЮ» Проректор по научной работе ведущей организации Федерального государственного бюджетного образовательного учреждения высшего образования «Российский национальный исследовательский медицинский

Подробнее

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА доктора медицинских наук, профессора Котова С.В. на диссертацию Кимельфельд Екатерины Игоревны «Клинико-генетические аспекты ишемического инсульта у пациентов в возрасте до

Подробнее

Впервые определены дополнительные факторы риска диабетической нефропатии у детей: низкая масса при рождении, наличие сочетанных микрососудистых

Впервые определены дополнительные факторы риска диабетической нефропатии у детей: низкая масса при рождении, наличие сочетанных микрососудистых отзыв на автореферат диссертации Кисельниковой Ольги Викторовны на тему «Прогнозирование и ранняя диагностика диабетической нефропатии у детей», представленной на соискание ученой степени кандидата медицинских

Подробнее

Отзыв. Болезнь Вильсона-Коновалова (БВК) представляет собой аутосомнорецессивное. генетическое заболевание, которое включено в число орфанных

Отзыв. Болезнь Вильсона-Коновалова (БВК) представляет собой аутосомнорецессивное. генетическое заболевание, которое включено в число орфанных Отзыв официального оппонента, доктора медицинских наук, профессора Винницко й Елены Владимировны на диссертацию Балашовой Марии Сергеевны «Оценка спектра мутаций гена АТР7В и клинического полиморфизма

Подробнее

Алгоритм лечения перфичного. миелофиброза. (по A. Tefferi, )

Алгоритм лечения перфичного. миелофиброза. (по A. Tefferi, ) Алгоритм лечения перфичного миелофиброза (по A. Tefferi, 2011-2012) ДИАГНОЗ ПМФ Леналидомид (при наличии симптомов) Да Наличие 5q Нет Стратификация риска по DIPSS Plus 2 Очень высокий риск Ме=9 мес; 2-х

Подробнее

Эволюция методов молекулярной диагностики хронического миелолейкоза. А.В. Мисюрин

Эволюция методов молекулярной диагностики хронического миелолейкоза. А.В. Мисюрин Эволюция методов молекулярной диагностики хронического миелолейкоза А.В. Мисюрин 1960 год: Ph-хромосома A Minute Chromosome in Human Chronic Granulocytic Leukemia P.C. Nowell, D.A. Hungerford University

Подробнее

Молекулярная биология

Молекулярная биология Молекулярная биология Лекция 14. Молекулярные основы канцерогенеза. Скоблов Михаил Юрьевич Что такое рак? Рак это группа заболеваний, характеризующая ненормальным и неконтролируемым ростом клеток Рак возникает

Подробнее

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА на диссертационную работу Гаджиева Газимагомеда Дибирдадаевича «Оптимизация оказания медицинской помощи при крупных и

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА на диссертационную работу Гаджиева Газимагомеда Дибирдадаевича «Оптимизация оказания медицинской помощи при крупных и ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА на диссертационную работу Гаджиева Газимагомеда Дибирдадаевича «Оптимизация оказания медицинской помощи при крупных и коралловидных камнях единственной или единственно-функционирующей

Подробнее

А.А.Русанова, одно из немногих отечественных исследований в таком аспекте, актуальна вдвойне. Диссертация написана по классическому образцу и состоит

А.А.Русанова, одно из немногих отечественных исследований в таком аспекте, актуальна вдвойне. Диссертация написана по классическому образцу и состоит Отзыв официального оппонента профессора Пикина Олега Валентиновича на диссертацию Русанова А.А. «Эндобронхиальное лечение распространенного немелкоклеточного рака легкого» на соискание ученой степени доктора

Подробнее

Мутации генов BRCA1 и BRCA2

Мутации генов BRCA1 и BRCA2 Мутации генов Мутации генов BRCA1 и BRCA2 Тестирование мутаций в генах BRCA1 и BRCA2 в рамках программы «Совершенствование молекулярно-геической диагностики в Российской Федерации», выполняется у пациенток

Подробнее

ПРОЕКТ. Клинические рекомендации по диагностике и лечению детей, больных острыми лейкозами

ПРОЕКТ. Клинические рекомендации по диагностике и лечению детей, больных острыми лейкозами ОБЩЕРОССИЙСКИЙ СОЮЗ ОБЩЕСТВЕННЫХ ОБЪЕДИНЕНИЙ АССОЦИАЦИЯ ОНКОЛОГОВ РОССИИ ПРОЕКТ Клинические рекомендации по диагностике и лечению детей, больных острыми лейкозами Коллектив авторов (в алфавитном порядке):

Подробнее

«УТВЕРЖДАЮ» Ректор Института усовершенствования врачей федерального государственного бюджетного учреждения «Национальный медикохирургический

«УТВЕРЖДАЮ» Ректор Института усовершенствования врачей федерального государственного бюджетного учреждения «Национальный медикохирургический «УТВЕРЖДАЮ» Ректор Института усовершенствования врачей федерального государственного бюджетного учреждения «Национальный медикохирургический Центр имени Н.И. Пирогова» Министерства здравоохранения Российской

Подробнее

ОТЗЫВ официального оппонента на диссертационную работу Уржумова Павла Валерьевича «Полиморфизмы генов репарации ДНК, клеточного цикла и апоптоза как г

ОТЗЫВ официального оппонента на диссертационную работу Уржумова Павла Валерьевича «Полиморфизмы генов репарации ДНК, клеточного цикла и апоптоза как г ОТЗЫВ официального оппонента на диссертационную работу Уржумова Павла Валерьевича «Полиморфизмы генов репарации ДНК, клеточного цикла и апоптоза как генетические маркеры индивидуальной радиочувствительности

Подробнее

ДРУЙ АЛЕКСАНДР ЕВГЕНЬЕВИЧ, дата защиты г.

ДРУЙ АЛЕКСАНДР ЕВГЕНЬЕВИЧ, дата защиты г. ДРУЙ АЛЕКСАНДР ЕВГЕНЬЕВИЧ, дата защиты 19.05.2015г. Тема диссертации: «Прогностическое значение молекулярно-генетических маркеров у пациентов с нейробластомой» по специальностям: 14.01.12 онкология, 14.03.10

Подробнее

Научная новизна полученных результатов исследования, выводов и * рекомендаций

Научная новизна полученных результатов исследования, выводов и * рекомендаций отзыв официального оппонента, доктора медицинских наук, профессора, заведующей кафедрой эндокринологии лечебного факультета Федерального государственного бюджетного образовательного учреждения высшего

Подробнее

Отзыв. официального оппонента, заведующего кафедрой неврологии и

Отзыв. официального оппонента, заведующего кафедрой неврологии и Отзыв официального оппонента, заведующего кафедрой неврологии и нейрохирургии Института после дипломного обра зования Федерального государственного бюджетного образовательного учреждения высшего образования

Подробнее

Опыт применения руксолитиниба в РКБ имени Н. А. Семашко у пациентов с миелофиброзом

Опыт применения руксолитиниба в РКБ имени Н. А. Семашко у пациентов с миелофиброзом Опыт применения руксолитиниба в РКБ имени Н. А. Семашко у пациентов с миелофиброзом Алексеева А.Н. РКБ им. Н. А. Семашко www.rkbsemashko.ru Актуальность проблемы Неутешительный прогноз, малая эффективность

Подробнее

Клиническое значение мониторинга циркулирующих в крови опухолевых клеток при диссеминированном раке молочной железы

Клиническое значение мониторинга циркулирующих в крови опухолевых клеток при диссеминированном раке молочной железы Клиническое значение мониторинга циркулирующих в крови опухолевых клеток при диссеминированном раке молочной железы Бжадуг Оксана Борисовна Отделение клинической фармакологии и химиотерапии РОНЦ им. Н.Н.

Подробнее

3. Требования к результатам освоения программы дисциплины (модуля) «Медицинская генетика» по формированию компетенций

3. Требования к результатам освоения программы дисциплины (модуля) «Медицинская генетика» по формированию компетенций Аннотация к рабочей программе дисциплины (модуля) «Медицинская генетика» основной профессиональной образовательной программы подготовки кадров высшей квалификации в ординатуре по специальности 31.08.28

Подробнее

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ

ОТЗЫВ ВЕДУЩЕЙ ОРГАНИЗАЦИИ «УТВЕРЖДАЮ» Проректор по научной работе федерального государственного бюджетного образовательного учреждения высшего образования «Первый Санкт-Петербургский государственный медицинский университет имени

Подробнее

Теоретическая значимость исследования обоснована тем, что: доказаны положения, вносящие вклад в расширение представлений о закономерностях развития

Теоретическая значимость исследования обоснована тем, что: доказаны положения, вносящие вклад в расширение представлений о закономерностях развития 1 Заключение комиссии диссертационного совета Д 208.114.01 в Федеральном бюджетном учреждении науки «Центральный научноисследовательский институт эпидемиологии» Федеральной службы по надзору в сфере защиты

Подробнее

ФАРМАКОЭКОНОМИЧЕСКАЯ ОЦЕНКА ПРИМЕНЕНИЯ ПРЕПАРАТА ДАЗАТИНИБ В ТЕРАПИИ ВТОРОЙ ЛИНИИ ПАЦИЕНТОВ С ХРОНИЧЕСКИМ МИЕЛОИДНЫМ ЛЕЙКОЗОМ

ФАРМАКОЭКОНОМИЧЕСКАЯ ОЦЕНКА ПРИМЕНЕНИЯ ПРЕПАРАТА ДАЗАТИНИБ В ТЕРАПИИ ВТОРОЙ ЛИНИИ ПАЦИЕНТОВ С ХРОНИЧЕСКИМ МИЕЛОИДНЫМ ЛЕЙКОЗОМ IX НАЦИОНАЛЬНЫЙ КОНГРЕСС С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «РАЗВИТИЕ ФАРМАКОЭКОНОМИКИ И ФАРМАКОЭПИДЕМИОЛОГИИ В РОССИЙСКОЙ ФЕДЕРАЦИИ» г.уфа, 16-17 МАРТА 2015 года ОРИГИНАЛЬНЫЕ РОССИЙСКИЕ ФАРМАКОЭКОНОМИЧЕСКИЕ ИССЛЕДОВАНИЯ

Подробнее

отзыв Актуальность темы выполненной работы

отзыв Актуальность темы выполненной работы отзыв Официального оппонента доктора медицинских наук, профессора Беляковой Натальи Александровны на диссертационную работу Абулула Марии на тему «Влияние генетических полиморфизмов в генах CYP2C9 и SLC22Al(OCTl)

Подробнее

УТВЕРЖДАЮ: «ЛА» 2015 Г. Л к j / & Ректор ГБОУ ВПО НГМУ. осени. Маринкин Игорь Олегович. «d S T» /-е-с-.у /Уг-Д' 2015 г.

УТВЕРЖДАЮ: «ЛА» 2015 Г. Л к j / & Ректор ГБОУ ВПО НГМУ. осени. Маринкин Игорь Олегович. «d S T» /-е-с-.у /Уг-Д' 2015 г. УТВЕРЖДАЮ: Ректор Государственное бюджетное образовательное учреждение высшего профессионального образования «Новосибирский государственный медицинский университет» Министерства здравоохранения Российской

Подробнее

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА

ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА ОТЗЫВ ОФИЦИАЛЬНОГО ОППОНЕНТА на диссертационную работу Куриной Елены Сергеевны «Влияние статинов на эффективность эндоваскулярного лечения больных ИБС», представленной на соискание ученой степени кандидата

Подробнее

Клиническая оценка мутации гена K-RAS у пациентов с колоректальным раком

Клиническая оценка мутации гена K-RAS у пациентов с колоректальным раком Клиническая оценка мутации гена K-RAS у пациентов с колоректальным раком И.Г.Гатауллин,М.Г.Гордиев, Р.К.Шакиров ГБОУ ДПО КГМА МЗ РФ, РКОД МЗ РТ Казань 2016 г. Введение Колоректальный рак (КРР), является

Подробнее

Молекулярно-генетические исследования в онкологии: от цитогенетики к эпигенетике

Молекулярно-генетические исследования в онкологии: от цитогенетики к эпигенетике Молекулярно-генетические исследования в онкологии: от цитогенетики к эпигенетике Цепенко В.В., к.б.н. с.н.с. лаборатории молекулярно-генетической патологии клинико-морфологического отдела МРНЦ им. А.Ф.

Подробнее

Анемический синдром при гемобластозах

Анемический синдром при гемобластозах Анемический синдром при гемобластозах А.В. Колганов 2006 г. Анемический синдром при гемобластозах. Анемический синдром при гемобластозах является закономерным явлением и проявлением основного заболевания.

Подробнее

КЛИНИКО-ЛАБОРАТОРНАЯ ХАРАКТЕРИСТИКА И ОЦЕНКА ЭФФЕКТИВНОСТИ ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОИДНОГО ЛЕЙКОЗА НА ТЕРРИТОРИИ ПРИМОРСКОГО КРАЯ

КЛИНИКО-ЛАБОРАТОРНАЯ ХАРАКТЕРИСТИКА И ОЦЕНКА ЭФФЕКТИВНОСТИ ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОИДНОГО ЛЕЙКОЗА НА ТЕРРИТОРИИ ПРИМОРСКОГО КРАЯ 1-2013 г. 14.00.00 медицинские науки УДК 615.155.392.8-07-085(571.63) КЛИНИКО-ЛАБОРАТОРНАЯ ХАРАКТЕРИСТИКА И ОЦЕНКА ЭФФЕКТИВНОСТИ ТЕРАПИИ ХРОНИЧЕСКОГО МИЕЛОИДНОГО ЛЕЙКОЗА НА ТЕРРИТОРИИ ПРИМОРСКОГО КРАЯ

Подробнее

ОТЗЫВ Актуальность темы исследования

ОТЗЫВ Актуальность темы исследования ОТЗЫВ официального оппонента доктора медицинских наук, профессора Абдулхакова Рустама Аббасовича на диссертационную работу Степиной Екатерины Александровны «Клинико-лабораторные показатели функции эндотелия

Подробнее

страдают в основном молодые люди. Нарастание двигательных, чувствительных, социального статуса, большим экономическим потерям.

страдают в основном молодые люди. Нарастание двигательных, чувствительных, социального статуса, большим экономическим потерям. отзыв официального оппонента академика РАН, доктора медицинских наук, профессора Яхно Николая Николаевича на диссертационную работу Бойко Ольги Владимировны на тему «Качество жизни больных рассеянным склерозом,

Подробнее

лечатся с использованием этих методов.

лечатся с использованием этих методов. ОТЗЫВ официального оппонента доктора медицинских наук, профессора В.В. Ковалева на диссертацию Порубовой Янины Петровны «Клинико-лабораторные и морфологические особенности состояния эндометрия при бесплодии

Подробнее

Ведущим направлением исследований ЦНИЛ, являются технологии : имеющие выход на решение задач практической медицины, входящие в список приоритетных

Ведущим направлением исследований ЦНИЛ, являются технологии : имеющие выход на решение задач практической медицины, входящие в список приоритетных Стратегия и перспективы развития науки и инноваций ЦНИЛ 2016год Ведущим направлением исследований ЦНИЛ, являются технологии : имеющие выход на решение задач практической медицины, входящие в список приоритетных

Подробнее

УТВЕРЖДАЮ Заместитель директора по науке и международным связям ГБУЗ МО МОНИКИ им. М.Ф. Владимирского наук, профессор Мол очков А.В.

УТВЕРЖДАЮ Заместитель директора по науке и международным связям ГБУЗ МО МОНИКИ им. М.Ф. Владимирского наук, профессор Мол очков А.В. УТВЕРЖДАЮ Заместитель директора по науке и международным связям ГБУЗ МО МОНИКИ им. М.Ф. Владимирского наук, профессор Мол очков А.В. 2017г ОТЗЫВ ведущей организации государственного бюджетного учреждения

Подробнее

грируют преимущественно в опухолевую ткань. Но данные последних лет свидетельствуют о том, что трансплантированные МСК обнаруживаются не только в

грируют преимущественно в опухолевую ткань. Но данные последних лет свидетельствуют о том, что трансплантированные МСК обнаруживаются не только в «УТВЕРЖДАЮ» 2016 г. ОТЗЫВ ведущей организации - Федерального государственного бюджетного научного учреждения «Институт молекулярной патологии и патоморфологии» - о научно-практической значимости диссертации

Подробнее

ЗАКЛЮЧЕНИЕ Медицинского института при Федеральном государственном бюджетном образовательном учреждении высшего образования «Чеченский государственный

ЗАКЛЮЧЕНИЕ Медицинского института при Федеральном государственном бюджетном образовательном учреждении высшего образования «Чеченский государственный Размещено на сайте ДГМУ в сети Интернет 18.05.2017г. 1 "УТВЕРЖДАЮ" Первый проректор ФГБОУ ВО ЗАКЛЮЧЕНИЕ Медицинского института при Федеральном государственном бюджетном образовательном учреждении высшего

Подробнее

отзыв Диссертационная работ а О. И. Ефремовой является одним из немногих исследований, посвящённых изучению возможности опера т ивного лечения

отзыв Диссертационная работ а О. И. Ефремовой является одним из немногих исследований, посвящённых изучению возможности опера т ивного лечения отзыв официального оппонента доктора медицинских наук Кунгурцева Евгения Вадимовича на диссертационную работу Ефремовой Оксаны Игоревны «Лечение венозного тромбоза у больных, нуждающихся в проведении травматологических

Подробнее

Общие сведения об онкологических заболеваниях

Общие сведения об онкологических заболеваниях Общие сведения об онкологических заболеваниях Anna Antonowich-Jonsson RN, MSN, FNP-BC City of Hope Duarte, CA USA Анна Антонович-Джонсон MSN, FNP-BC, OCN Город надежды Дюарт, Калифорния, США Данный материал

Подробнее