М.P.Кабилов 1, Г.М.Дымшиц 1, Д.В.Пышный 2, Е.М.Иванова 2, В.Ф.Зарытова 2, Н.М.Гашникова 3, А.Г.Покровский 3

Save this PDF as:

Размер: px
Начинать показ со страницы:

Download "М.P.Кабилов 1, Г.М.Дымшиц 1, Д.В.Пышный 2, Е.М.Иванова 2, В.Ф.Зарытова 2, Н.М.Гашникова 3, А.Г.Покровский 3"


1 КОЛОРИМЕТРИЧЕСКАЯ ДЕТЕКЦИЯ ТОЧЕЧНЫХ МУТАЦИЙ ПРИ ИММОБИЛИЗАЦИИ ФРАГМЕНТА АНАЛИЗИРУЕМОЙ ДНК С ПРОДУКТОМ ЛИГИРОВАНИЯ НА НЕМ ТАНДЕМА КОРОТКИХ ОЛИГОНУКЛЕОТИДОВ М.P.Кабилов 1, Г.М.Дымшиц 1, Д.В.Пышный 2, Е.М.Иванова 2, В.Ф.Зарытова 2, Н.М.Гашникова 3, А.Г.Покровский 3 1 Институт цитологии и генетики СО РАН , Новосибирск, просп. ак. Лаврентьева, 10 Лаборатория структуры генома, Института цитологии и генетики СО РАН тел.: (3832) , факс: (3832) еmail: 2 Новосибирский институт биоорганической химии СО РАН 3 ГНЦ ВБ «Вектор» В настоящее время в практике детекции мутаций при наследственных заболеваниях используется ряд подходов, которые позволяют выявлять мутации на продуктах ПЦР геномной ДНК. Одним из подходов к выявлению точечных мутаций является метод, в основе которого лежит ферментативное лигирование на ДНКматрице олигонуклеотидных зондов, комплементарных последовательности анализируемой ДНК в области предполагаемой нуклеотидной замены. Лигирование «мини-зондов» трех коротких олигонуклеотидов: окта-, тетра- и октамеров позволяет с высокой достоверностью определять однобуквенные замены в сайте связывания центрального тетрамера [1]. Нами предложен новый метод колориметрической детекции точечных мутаций, основанный на лигировании трех коротких олигонуклеотидов (трехкомпонентного тандема), один из которых несет остаток биотина, и детекции с помощью биотин-стрептавидиновой системы продукта лигирования, гибридизующегося с анализируемой ДНК-матрицей, иммобилизуемой на капроне УФ-облучением. Исследование проводили, используя в качестве анализируемой ДНК продукт ПЦР (135 bp) ДНК ВИЧ I. В результате лигирования тандема pn 8 + +pn 8 Bio на матрице анализируемой ДНК происходит образование биотинсодержащего двадцатизвенного продукта pn 20 Bio, который может быть выявлен колориметрически за счет связывания остатка биотина с конъюгатом стрептавидин-щелочная фосфатаза, инициирующим цветную реакцию. Для разделения биотинилированных олигонуклеотидов 20-звенного продукта лигирования pn 20 Bio и компонента тандема октануклеотида pn 8 Bio был использован метод иммобилизации протяженных молекул ДНК на капроне при УФоблучении. Мы предположили, что при облучении нанесенной на капрон реакционной смеси после лигирования из-за разницы в молекулярных весах в основном должна происходить иммобилизация анализируемой ДНК [2]. Длинная матрица, в свою очередь, должна удерживать на мембране 20-звенный продукт pn 20 Bio за счет прочного комплексообразования, в то время как октамер pn 8 Bio, образующий существенно менее стабильный комплекс, будет легко удаляться во время отмывок. Первоначально была проверена возможность однозначного специфического выявления продукта лигирования тандема трех коротких олигонуклеотидов (pn 8 + +pn 8 Bio) на ДНК-матрице. Выявление продукта лигирования проводили по следующей схеме. Тандем олигонуклеотидов и ДНК матрицу продукт ПЦР нагревали до 100 С для денатурации двуцепочечной структуры и резко охлаждали при

2 0 о С. При этом часть молекул одноцепочечной ДНК оказываются связанными в комплементарном комплексе с тандемом. После лигирования олигонуклеотидов с помощью ДНК-лигазы фага Т4 реакционную смесь наносили на капроновую мембрану и иммобилизовали УФ-светом. Капрон промывали буфером, содержащим детергент, инкубировали с конъюгатом «стрептавидин-щелочная фосфатаза», а затем с субстратами, образущими в результате реакции нерастворимый темно-синий осадок. Изменение окраски точек нанесения на мембране при проявлении продукта лигирования с помощью субстратов регистрировали сканированием (Microtek), данные обрабатывали с помощью программы «Gel-Pro», определяя интенсивность оптической плотности. Из данных, представленных на рисунке 1, видно, что после «проявления» в точке нанесения реакционной смеси, содержащей 20-звенный продукт pn 20 Bio, происходит интенсивное окрашивание (точка 1). В то же время в контрольной точке 2, в которой была нанесена та же смесь, но без этапа лигирования, развитие окраски практически не происходит. Это свидетельствует о том, что октамер, содержащий биотин, в результате отмывок не удерживается на мембране. фрагмент ДНК GCATCAAGCAGCTCCAGGCA 5' денатурация охлаждение + pn 8 + +pn 8 'Bio сигнальный продукт лигирования pn20bio T4 ДНК-лигаза pn 8 pcagc pn'8 Bio pgcatcaag ptccaggcapbio УФ-иммобилизация Е конъюгат стрептавидинщелочная фосфатаза хромогенные субстраты + BCIP NBT окрашивание капрона Е Изменение условий промывки мембраны: повышение температуры, способствующее разрушению комплементарного комплекса иммобилизованной ДНК и 20- звенного продукта лигирования, приводит к резкому падению интенсивности окраски при проявлении (точка 5). Отсутствие окраски на мембране наблюдается и при лигировании тандема на олигонуклеотиде М(20-мер) (точка 3).

3 Рис. 1. Сканированное изображение капрона после «проявления» соиммобилизованного с ДНК-матрицей продукта лигирования: 1 pn 8 + +pn 8 Bio + ДНК (135 bp) + Т4 ДНК-лигаза; 2 pn pn 8 Bio + ДНК (135 bp); 3 pn 8 + +pn 8 Bio + M (20-мер) + Т4 ДНК-лигаза; 4 pn 8 + +pn 8 Bio +M (20-мер); 5 pn 8 + +pn 8 Bio + ДНК (135 bp) + Т4 ДНК-лигаза (капрон отмыт при 80 С после иммобилизации ДНК-матрицы). Условия лигирования: 45 мин, 25 С, [pn 8 ]=[ ]=10-5 M, [pn 8 Bio]=[ДНК-матрица]=10-7 М; 0,1 M NaCl, 0,01 M дитиотреит, 0,01 M MgCl 2, 0,02 M трис-hcl (рн 7,5), 0,001 M ATP. Эти данные свидетельствуют о том, в условиях УФ-облучения лигируемый октамер pn 8 Bio и 20-звенный продукт лигирования pn 20 Bio, в отличие от протяженной ДНК-матрицы, не иммобилизуются на капроне, и проявление продукта лигирования происходит специфично вследствие избирательного удерживания его на капроне за счет комплексообразования с ДНК-матрицей. Поскольку эффективность иммобилизации возрастает с повышением дозы УФ, увеличение времени облучения может приводить к повышению количества соиммобилизованного на капроне детектируемого продукта pn 20 Bio, что должно приводить к повышению скорости проявления и интенсивности окрашивания мембраны в точке нанесения лигированной смеси. Поэтому на следующем этапе работы мы определили оптимальное время облучения для выявления специфического продукта лигирования на фрагменте ДНК ВИЧ I. Как видно из рисунка 2, с увеличением времени облучения до 2 минут интенсивность окраски существенно возрастает только в точках нанесения лигируемых смесей, т.е. содержащих продукт pn 20 Bio. В контрольных экспериментах без проведения этапа лигирования изменения интенсивности пятен практически не происходит. В дальнейших экспериментах использовали 2 минутное облучение, при котором наблюдается оптимальное соотношение специфического и неспецифического сигналов интенсивность окрашивания (%IOD) 100 ДНК-фрагмент 80 N20-матрица Рис. 2. Интенсивность окрашивания после «проявления» смесей, иммобилизованных на капроне УФ-облучением в течение 10, 30, 45, 120 и 300 сек, содержащих продукт лигирования и непрошедших этап лигирования (условия лигирования см. рис. 1): 1 pn 8 + +pn 8 Bio + ДНК-фрагмент (135 bp) +T4 ДНК-лигаза; 2 pn 8 + +pn 8 Bio + ДНК-фрагмент (135 bp). сек

4 Возможность выявления точечных мутаций в геномных ДНК проводили на модельных системах, вводя все возможные однонуклеотидные замены в последовательность тетрамера. Матрицей во всех случаях выступал фрагмент (135 bp) ДНК ВИЧ I. Было проведено лигирование 13 систем, 12 из которых содержали мисматчи в комплексах тетрамеров и ДНК-матрицы. Как видно из рисунка 3, интенсивная окраска наблюдается только в случае использования тетрануклеотида pcagc, полностью комплементарного анализируемому ДНК-фрагменту. При использовании тетрамеров с однобуквенной заменой интенсивность окрашивания хотя и зависит от типа мисматча, однако во всех случаях во много раз слабее, чем в совершенном комплексе. pxagc pcxgc pcaxc 1A 2G 3A N (pcagc) 1G 1T 2C 2T 3C 3T ДНК-фрагмент pgcatcaag ptccaggca-bio pcagc (N) pxagc pcxgc pcaxc pcagx (X1), X=A,G,T (X2), X=G,C,T (X3), X=A,C,T (X4), X=A,G,T pcagx 4A 4G 4T Рис. 3. Сканированное изображение капрона после проявления продуктов лигирования, гибридизующихся с ДНК-матрицей, иммобилизуемой УФ-облучением. Таким образом, предлагаемый метод позволяет тестировать однобуквенные несоответствия между последовательностью тетрамера и сайтом его связывания на анализируемой ДНК, а также однозначно определить, в каком месте сайта связывания тетрамера имеется мутация и какая именно замена произошла. Разработанный подход был использован для различения двух штаммов ВИЧ при использовании их ПЦР продуктов. Один из этих фрагментов ДНК (135 bp) штамм mn был использован в предыдущих экспериментах. Последовательность штамма rf (180 bp) отличается от первого одним нуклеотидным звеном (C A). При этом следует отметить, что замена находится в сайте связывания октамерного компонента тандема pn 8 в точке лигирования. Из рисунка 4 видно, что типы штаммов даже в этом случае легко различаются по интенсивности окрашивания после проявления. Следовательно, использование разработанного нами подхода позволяет выявлять мутации в сайте связывания не только тетрануклеотида, но и октамера, когда замена обуславливает наличие мисматча на стыке лигируемых олигонуклеотидов. Таким образом, в работе предложен колориметрический метод достоверной детекции точечных мутаций в ДНК, основанный на лигировании на ней тандема трех коротких олигонуклеотидов, один из которых содержит остаток биотина, и последующей иммобилизации на подложке анализируемой ДНК с комплементарным продуктом лигирования.

5 ДНК-фрагмент штамма mn C G Bio ДНК-фрагмент штамма rf A G Bio Рис. 4. Сканированное избраже-ние капрона после проявления продуктов лигирования тандема pn 8 + +pn 8 Bio в присутствии ДНК-фрагментов штаммов mn и rf ВИЧ I. Список литературы 1. Пышный Д.В., Кривенко А.А., Лохов С.Г. и др. Взаимодействие производных коротких олигонуклеотидов с нуклеиновыми кислотами VI. Дискриминация комплексов, содержащих мисматч, при лигировании тандема коротких олигонуклеотидов на ДНК-матрице // Биоорган. химия Т. 24. С Калачиков С.М., Адаричев В.А., Дымшиц Г.М. Иммобилизация ДНК на микропористых мембранах с помощью УФ-облучения // Биоорган. химия Т. 18. С

Рекомендации по постановке ПЦР

Рекомендации по постановке ПЦР Рекомендации по постановке ПЦР К наборам реактивов ## PK101, PK121. К полимеразам ## PK002S/L, PK013, PK014, PK015, PK016, PK022, PK123S/L. К готовым смесям для ПЦР ## PK041S/L, PK143S/L, PK145S/L, PK147S/L,


Поэтому не вызывает сомнений актуальность настоящей работы, в которой разработаны универсальные подходы к получению пиренильных конъюгатов

Поэтому не вызывает сомнений актуальность настоящей работы, в которой разработаны универсальные подходы к получению пиренильных конъюгатов 1 Поэтому не вызывает сомнений актуальность настоящей работы, в которой разработаны универсальные подходы к получению пиренильных конъюгатов олигонуклеотидов, изучены их свойства и продемонстрирована перспективность


Глава 11 Методы анализа генов

Глава 11 Методы анализа генов Глава 11 Методы анализа генов 1. CS Ферменты рестрикции: a) используются в ПЦР; b) узнают одноцепочечную ДНК; c) узнают и разрезают специфические двуцепочечные последовательности ДНК; d) встречаются у



МЕТОДЫ АНАЛИЗА ГЕНОВ 12 МЕТОДЫ АНАЛИЗА ГЕНОВ Гены являются молекулярным субстратом наследственности. Структура и локализация генов в геноме определяет свойства организма. При функционировании генома и в результате взаимодействия


Tornado Taq-полимераза (hot-start)

Tornado Taq-полимераза (hot-start) Tornado Taq-полимераза (hot-start) Tornado Taq-полимераза является уникальным ферментом, обладающим повышенной термостабильностью, устойчивостью к ингибиторам ПЦР и повышенной скоростью синтеза ДНК по



ДНК-ЗОНДЫ И ИХ ИСПОЛЬЗОВАНИЕ В ВИРУСОЛОГИИ Галина Я.С., Николаева О.Н. ФГБОУ ВО Башкирский ГАУ Уфа, Россия ДНК-ЗОНДЫ И ИХ ИСПОЛЬЗОВАНИЕ В ВИРУСОЛОГИИ Галина Я.С., Николаева О.Н. ФГБОУ ВО Башкирский ГАУ Уфа, Россия THE DNK-PROBES AND THEIR USE IN VIROLOGY Galina Y.S., Nikolaeva O.N. The Bashkir State Agrarian


Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции

Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции Новые технологии в молекулярной диагностике инфекционных, наследственных и Филатова Людмила К.б.н Менеджер по продукции Генетические технологии не роскошь, а средство Основные направления развития диагностических


Комплексное решение для молекулярных исследований

Комплексное решение для молекулярных исследований Комплексное решение для молекулярных исследований Ведерников Виталий Евгеньевич, к.б.н., руководитель группы ПЦР Лаборатории молекулярной диагностики ООО «Вега» ГК «Алкор Био» http://forpcr.ru Taq M Hot-Start


Гибридизация нуклеиновых кислот

Гибридизация нуклеиновых кислот Гибридизация нуклеиновых кислот Гибридизация нуклеиновых кислот T m температура плавления Методы, основанные на гибридизации нуклеиновых кислот Хорошо охарактеризованная ДНК или олигонуклеотидные фрагменты


Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015

Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015 Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015 Процедура Идеальная процедура анализа в анализа в молекулярной


Метод гель-электрофореза

Метод гель-электрофореза Метод гель-электрофореза Назначение метода и принцип его действия. Гель-электрофорез аналитический метод для разделения и анализа макромолекул (нуклеиновых кислот и белков) размером от 20 до 2000 кда.


Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М.

Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М. Ключевые методы молекулярной биологии. Секвенирование по Сенгеру Докладчик: Шадрин Д.М. 1 История разработки метода Фридрих Мишер Николай Открытие ДНК Константинович 1869 год. Кольцов Структура ДНК, 1927


Номера по каталогу BC35T, BC35S, BC35M, BC35L

Номера по каталогу BC35T, BC35S, BC35M, BC35L КлинМаг ДНК Набор реактивов Номера по каталогу BC35T, BC35S, BC35M, BC35L Набор для очистки ДНК на магнитных частицах Инструкция по применению Набор реактивов КлинМаг ДНК предназначен только для исследовательских


ДНК-макроматрицы и транскрипционное профилирование

ДНК-макроматрицы и транскрипционное профилирование БИОНАНОТЕХНОЛОГИИ Ю.Копа, К.Момыналиев ДНК-макроматрицы и транскрипционное профилирование Современные ДНК-матрицы являются высокочувствительным и точным аналитическим инструментом для научного исследования






ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ Метод иммуноферментного анализа ОФС. Вводится впервые Настоящая общая фармакопейная статья распространяется на


Набор «ФБиоГель» для выделения двунитевой ДНК из геля или очистки от реакционной смеси на центрифужных колонках. (НК-2-4, НК-2-50)

Набор «ФБиоГель» для выделения двунитевой ДНК из геля или очистки от реакционной смеси на центрифужных колонках. (НК-2-4, НК-2-50) Набор «ФБиоГель» для выделения двунитевой ДНК из геля или очистки от реакционной смеси на центрифужных колонках. (НК-2-4, НК-2-50) Содержание Компоненты набора... 3 Условия и срок хранения... 3 Ограничения


Набор реактивов MMLV RT kit

Набор реактивов MMLV RT kit Набор реактивов MMLV RT kit Номер по каталогу SK021 Инструкция по применению Набор реактивов MMLV RT kit предназначен только для исследовательских работ, выполняемых профессионально подготовленными пользователями.


Продукт Кат. # Количество. pal2-t вектор TA мкг (на 25 реакций)

Продукт Кат. # Количество. pal2-t вектор TA мкг (на 25 реакций) pal2-t вектор Продукт Кат. # Количество pal2-t вектор TA002 1.25 мкг (на 25 реакций) Лиофильно высушенный продукт. Хранение: -20 C Транспортировка: комнатная температура (не более недели) либо -20 C Срок


«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г.

«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г. «Использования технологий TECAN в автоматизации NAT-тестирования Яцун Екатерина г. Ростов-на-Дону, 13-14 октября 2010 г. Актуальность В Европе с 1999 года ПЦР обязательный метод для тестирования всей донорской


Набор реактивов для очистки ДНК на магнитных частицах

Набор реактивов для очистки ДНК на магнитных частицах CleanMag DNA Набор реактивов для очистки ДНК на магнитных частицах Номера по каталогу BC35T BC35S BC35M BC35L Инструкция по применению Набор реактивов CleanMag DNA предназначен только для исследовательских


Молекулярная диагностика онкогематологических заболеваний. Филатова Людмила Менеджер по продукции К.б.н

Молекулярная диагностика онкогематологических заболеваний. Филатова Людмила Менеджер по продукции К.б.н Молекулярная диагностика онкогематологических заболеваний Филатова Людмила Менеджер по продукции К.б.н Сравнительные характеристики методик Метод Морфология FISH Проточная цитофлуориметри я ОТ-ПЦР (транслокации)


стероидов Итого по курсу

стероидов Итого по курсу ПРОГРАММА спецкурса «Химия биополимеров» Лектор к.х.н. Е.Л. Черноловская. (24 часа). 1.1 Естественно-научная дисциплина, вузовская. 1.2 Цели и задачи курса. Дисциплина «Химия биополимеров» предназначена


ВВЕДЕНИЕ Актуальность выпускной квалификационной работы Цель и задачи исследования. задачи:

ВВЕДЕНИЕ Актуальность выпускной квалификационной работы Цель и задачи исследования. задачи: ВВЕДЕНИЕ Актуальность выпускной квалификационной работы. Разработка новых ферментативных систем позволяет усовершенствовать старые и предложить новые варианты анализа для целей здравоохранения и охраны





Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак»

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Готовые решения для лабораторной диагностики молекулярными методами Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Исследование фрагментов нуклеиновых кислот (ДНК или РНК) Основные этапы: В клетке


Анализ образцов пищевых продуктов на присутствие генетически модифицированных организмов. Сессия 9

Анализ образцов пищевых продуктов на присутствие генетически модифицированных организмов. Сессия 9 Анализ образцов пищевых продуктов на присутствие генетически модифицированных организмов Сессия 9 Качественная детекция кукурузы MON810, кукурузы Bt-176 и сои RoundupReady методом ПЦР М. Кверчи, М. Маретти,


Библиотеки кднк. А.Г.Евстафьева. 24 февраля 2011 г.

Библиотеки кднк. А.Г.Евстафьева. 24 февраля 2011 г. Библиотеки кднк А.Г.Евстафьева 24 февраля 2011 г. Получение кднк мрнк Нуклеаза S1 кднк Получение кднк + ДНК-лигаза (вариант использовать статистический Получение библиотеки кднк Обработка кднк метилазой


ПЦР в реальном времени

ПЦР в реальном времени ПЦР в реальном времени Одним из самых современных вариантов ПЦР является ПЦР в реальном времени(3). Название отражает общий смысл новой модификации. ПЦР в реальном времени основана на количественной детекции


Система LightCycler 96. Инновационная система для ПЦР анализа в реальном времени

Система LightCycler 96. Инновационная система для ПЦР анализа в реальном времени Система LightCycler 96 Инновационная система для ПЦР анализа в реальном времени Система LightCycler 96 объединяет компактный дизайн и высокую производительность и позволяет проводить самые различные виды


Методы исследования нуклеиновых кислот. I. Гибридизация

Методы исследования нуклеиновых кислот. I. Гибридизация Методы исследования нуклеиновых кислот I. Гибридизация Что можно исследовать? Первичная последовательность НК Одна из фундаментальных задач молекулярной биологии и биохимии Определенные мутации Пренатальная


RU (11) (51) МПК C12Q 1/68 ( )

RU (11) (51) МПК C12Q 1/68 ( ) РОССИЙСКАЯ ФЕДЕРАЦИЯ (19) RU (11) (51) МПК C12Q 1/68 (2006.01) 2015 151 954 (13) A ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ (12) ЗАЯВКА НА ИЗОБРЕТЕНИЕ (21)(22) Заявка: 2015151954, 02.05.2014


Биотинилирование антител, белков & Выделение клеток с использованием магнитных частиц, покрытых стрептавидином

Биотинилирование антител, белков & Выделение клеток с использованием магнитных частиц, покрытых стрептавидином 2002-2004 НП АО "Силекс М" тел.: (095) 998 42 88, 737 42 24 факс: (095) 737 42 24 Эл.почта: info@sileks.com Интернет: www.sileks.com Биотинилирование антител, белков & Выделение клеток с использованием


Encyclo Plus PCR kit

Encyclo Plus PCR kit Encyclo Plus PCR kit Набор реактивов Номер по каталогу PK101 Инструкция по применению Набор реактивов Encyclo Plus PCR kit предназначен только для исследовательских работ, выполняемых профессионально подготовленными



МОЛЕКУЛЯРНО- ГЕНЕТИЧЕСКИЙ МЕТОД P A R T N E R ' S P R E S E N T A T I O N МОЛЕКУЛЯРНО- ГЕНЕТИЧЕСКИЙ МЕТОД Вороная Ю.М 1мед 1группа S E C T I O N F O U R МОЛЕКУЛЯРНО - ГЕНЕТИЧЕСКИЕ МЕТОДЫ Большая и разнообразная группа методов, предназначенная


УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г.

УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г. УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г. Календарно - тематический план лекций по дисциплине «Методы и объекты генетического анализа»



ИНСТРУКЦИЯ VIBRIO СHOLERAE ИНСТРУКЦИЯ по применению комплекта реагентов для проведения ПЦРамплификации ДНК токсигенных штаммов холерного вибриона VIBRIO СHOLERAE ВНИМАНИЕ! Vibrio cholerae относится ко II группе патогенности. Все





Quick-TA kit. Состав и условия хранения. Набор для быстрого клонирования ПЦР продуктов Кат. #TAK02 На 50 реакций

Quick-TA kit. Состав и условия хранения. Набор для быстрого клонирования ПЦР продуктов Кат. #TAK02 На 50 реакций Quick-TA kit Набор для быстрого клонирования ПЦР продуктов Кат. #TAK02 На 50 реакций Состав и условия хранения Компонент pal2-t вектор, лиофилизированный Quick-TA T4 DNA Ligase (200 ед/мкл ) 5X Quick ligation


Молекулярная диагностика возбудителей заболеваний картофеля

Молекулярная диагностика возбудителей заболеваний картофеля Молекулярная диагностика возбудителей заболеваний картофеля Владимир Карандашов, к.б.н. Руководитель лаборатории диагностики фитопатогенов ООО «Исследовательский центр «ФитоИнженерия» Московская область,


«Автоматизация процесса пробоподготовки в ПЦР анализе»

«Автоматизация процесса пробоподготовки в ПЦР анализе» «Автоматизация процесса пробоподготовки в ПЦР анализе» Яцун Екатерина «Актуальные проблемы современной лабораторной диагностики» г. Барнаул, июнь 2010 г. Полимеразная цепная реакция (ПЦР): общие принципы


Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени

Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени Инструкция по применению набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени (2Х премикс для ПЦР-РВ) Комплектация: Компонент На 200 реакций Объем реакции


ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ

ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ ИНСТРУКЦИЯ по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ Регистрационное удостоверение МЗ СР РФ ФСР 2010/08412 ВНИМАНИЕ! Изучите инструкцию



РАЗДЕЛ II ГЕННАЯ ИНЖЕНЕРИЯ ОСНОВНЫЕ ТЕОРЕТИЧЕСКИЕ ПОЛОЖЕНИЯ РАЗДЕЛ II ГЕННАЯ ИНЖЕНЕРИЯ ОСНОВНЫЕ ТЕОРЕТИЧЕСКИЕ ПОЛОЖЕНИЯ Генная инженерия это отрасль молекулярной биологии и генетики, целью которой является получение с помощью лабораторных приемов организмов с новыми,


МГУ имени М.В. Ломоносова. Химический факультет

МГУ имени М.В. Ломоносова. Химический факультет МГУ имени М.В. Ломоносова Химический факультет Химические курсы (для всех групп): 1 год Неорганика курсовая 2 год Аналитика курсовая Радиохимия 3 год Органика курсовая Химические основы биологических процессов


Оглавление. Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11

Оглавление. Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11 Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11 Глава 1. Теоретические основы биохимического анализа...13 (разд. 1.7 в соавторстве с



CATEDRA DE BIOCHIMIE ȘI BIOCHIMIE CLINICA INDICAȚIE METODICA FACULTATEA SĂNĂTATE PUBLICĂ, ANUL I Pag. 1 / 6 FACULTATEA SĂNĂTATE PUBLICĂ, ANUL I Pag. 1 / 6 Analizată și aprobată la ședința catedrei din, proces verbal nr șeful catedrei de Biochimie și Biochimie Clinică, conferențiar universitar, doctor habilitat





Набор реагентов для выявления контаминации микоплазмой в культурах клеток Инструкция по применению

Набор реагентов для выявления контаминации микоплазмой в культурах клеток Инструкция по применению MycoReport Набор реактивов Номер по каталогу: MR001 Набор реагентов для выявления контаминации микоплазмой в культурах клеток Инструкция по применению Набор реактивов предназначен только для исследовательских


Задания А36 по биологии

Задания А36 по биологии Задания А36 по биологии 1. Верны ли следующие суждения? А. Кроссинговер способствует сохранению наследственной информации при делении соматических клеток. Б. Геномные мутации ведут к возникновению наследственных


Микрочипы (microarrays)

Микрочипы (microarrays) Микрочипы (microarrays) ДНК-микрочипы Организованное размещение молекул ДНК на специальном носителе. кднк - двухкрасочные; Олигонуклеотиды - однокрасочные; - двухкрасочные; Флуоресцентная детекция Мембранные


Резюме - краткое изложение информации по какому-либо изученному материалу. Необходимо изложить пройденную тему в 5-7 предложениях, используя термины.

Резюме - краткое изложение информации по какому-либо изученному материалу. Необходимо изложить пройденную тему в 5-7 предложениях, используя термины. Задания для внеаудиторной работы студентов специальности медицинская биохимия 1 курс. Резюме - краткое изложение информации по какому-либо изученному материалу. Необходимо изложить пройденную тему в 5-7


Методы исследования нуклеиновых кислот. III. Секвенирование

Методы исследования нуклеиновых кислот. III. Секвенирование Методы исследования нуклеиновых кислот III. Секвенирование Секвенирование 1977 г. Maxam-Gilbert and Sanger Sequencing 2005 г. Next-Generation Sequencing Virus 3222 (Bacteriophage phix 174, 5386 пн 1977


Биосенсорные системы. часть 2. Крытынская Елена Николаевна. Тест-реакция биологического тестирующего элемента. Биологический тестирующий элемент.

Биосенсорные системы. часть 2. Крытынская Елена Николаевна. Тест-реакция биологического тестирующего элемента. Биологический тестирующий элемент. Биосенсорные системы LOGO 2017 Крытынская Елена Николаевна часть 2 Тест-реакция биологического тестирующего элемента. Биологический тестирующий элемент. ВОПРОСЫ ЛЕКЦИИ 2 2 1. Базовые аналитические характеристики



ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ Бактериальные ОФС.1...0006.15 эндотоксины Взамен ГФ XII, ч.1 ОФС -006-07 Настоящая статья описывает методы определения бактериальных


5 баллов, вы получаете от ассистентов (LA) за точное выполнение указаний по технике

5 баллов, вы получаете от ассистентов (LA) за точное выполнение указаний по технике III лаборатория Номер рабочего места: Продолжительность работы 60 минут; 40 баллов Задание: Разделение фрагментов ДНК плазмиды px, полученных в агарозном гель-электрофорезе и построениерестрикционной карты



ТЕХНОЛОГИЯ РЕКОМБИНАНТНЫХ ДНК 11 ТЕХНОЛОГИЯ РЕКОМБИНАНТНЫХ ДНК Расшифровывая тайны структуры генов, ученые начали их выделять и синтезировать. 30 лет назад тех, которые верили в успех этих начинаний было мало, и никто даже не предполагал








Преподавание курса фармацевтической биотехнологии

Преподавание курса фармацевтической биотехнологии Преподавание курса фармацевтической биотехнологии в ММА им. И.М.Сеченова. 1 Целью изучения курса биотехнологии студентами фармацевтических факультетов медицинских вузов является: формирование системных



ТРАНСГЕНЕЗ. МИКРООРГАНИЗМЫ. ВВЕДЕНИЕ В БИОТЕХНОЛОГИЮ Лекция 5 ТРАНСГЕНЕЗ. МИКРООРГАНИЗМЫ ВВЕДЕНИЕ В БИОТЕХНОЛОГИЮ Лекция 5 Перспективы развития генетической инженерии 1 2 3 4 Получение ДНК зондов для исследования структуры, функций и экспрессии генов Развитие «обратной


Институт медицинской биотехнологии ФБУН ГНЦ ВБ Вектор, Бердск, Россия

Институт медицинской биотехнологии ФБУН ГНЦ ВБ Вектор, Бердск, Россия Мамедова Л.В. 1, Лебедев Л.Р. 2 1 Дипломница, ФГБОУ ВО Кубанский государственный университет, Краснодар; 2 д.м.н., зав. лабораторией нуклеиновых кислот и рекомбинантных белков, Институт медицинской биотехнологии


Тема: Молекулярные основы наследственности

Тема: Молекулярные основы наследственности Тема: Молекулярные основы наследственности План лекции: 1. Нуклеиновые кислоты классификация, строение, функции. 2. Макромолекулярная структура ДНК 3. РНК: виды, структура, функции Два вида НК: ДНК (хранение


молекулярной биологии и генетики

молекулярной биологии и генетики Новейшие достижения молекулярной биологии и генетики в борьбе с сердечно-сосудистыми патологиями г е н е р а л ь н ы й д и р е к т о р Ф Г Б У «С е в е р о - З а п а д н ы й ф е д е р а л ь н ы й м е д


ДНКаптамеры. Технология, актуальность, перспективы

ДНКаптамеры. Технология, актуальность, перспективы ДНКаптамеры Технология, актуальность, перспективы Лаборатория аналитической биоорганической химии Лимнологический институт СО РАН, 2012 Решаемая задача Наука Поиск молекул с заданной биологической активностью


Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов.

Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. Рекомбинация может происходить путем обмена клеточными ядрами, целыми


11 класс. Задание 1. Решение

11 класс. Задание 1. Решение 11 класс Задание 1 Бесцветное, нерастворимое в воде вещество А принадлежит ароматическому ряду. А имеет приятный запах гиацинта и используется в парфюмерии. При взаимодействии 1,2 г вещества с избытком



МЕТОДЫ ИММОБИЛИЗАЦИИ. Лекция 3 МЕТОДЫ ИММОБИЛИЗАЦИИ Лекция 3 План лекции 1. Классификация методов иммобилизации. Способы физической и химической иммобилизации биокатализаторов. 2. Адсорбционная иммобилизация: типы носителей, природа


Структура работы: всего 19 заданий из них : 15 заданий- части А 2 задания части В и 2 задания части С

Структура работы: всего 19 заданий из них : 15 заданий- части А 2 задания части В и 2 задания части С КАРТА ОЦЕНКИ КАЧЕСТВА ЗНАНИЙ БИОЛОГИЯ 9 класс (1 триместр) Проверяемые понятия и темы : Разделы биологии, раскрывающие общие закономерности организации, значение биологических знаний для познания окружающего


Инструкция по применению набора для выделения ДНК из пищевых продуктов и сырья

Инструкция по применению набора для выделения ДНК из пищевых продуктов и сырья Компания «Биосилика» (383)2-999-245 info@biosilica.ru Инструкция по применению набора для выделения ДНК из пищевых продуктов и сырья На 50 выделений Состав набора: Микроколонки 50 шт 2 мл пробирки 50 шт


Тема: «Нуклеиновые кислоты. ДНК»

Тема: «Нуклеиновые кислоты. ДНК» Глава I. Основы цитологии На дом: 12 Тема: «Нуклеиновые кислоты. ДНК» Задачи: Дать характеристику нуклеиновым кислотам: видам НК, локализации их в клетке, строению, функциям. Изменено, дополнено Нуклеиновые


Белорусский государственный университет

Белорусский государственный университет Белорусский государственный университет Генная инженерия Учебная программа (рабочий вариант) по специальности: 1-31 01 01 Биология (по направлениям) направление 1-31 01 01-03 Биология (биотехнология) Факультет


Системы Fludigm для проведения высокопроизводительного ПЦР

Системы Fludigm для проведения высокопроизводительного ПЦР Системы Fludigm для проведения высокопроизводительного ПЦР Системы Fludigm для проведения высокопроизводительного ПЦР Платформа Fluidigm работает на основе инновационной технологии, которая значительно


ПЦР в реальном времени

ПЦР в реальном времени ПЦР в реальном времени Система LightCycler 96 Кузнецов Андрей Специалист по продукции ООО «Рош Диагностика Рус» picture placeholder Содержание Характеристики прибора Применение софта Основные преимущества


Московский государственный университет путей сообщения (МИИТ) Кафедра «Химия и инженерная экология»

Московский государственный университет путей сообщения (МИИТ) Кафедра «Химия и инженерная экология» Московский государственный университет путей сообщения (МИИТ) Кафедра «Химия и инженерная экология» Группа Студент (ФИО студента, дата выполнения) Преподаватель Отчёт принят (ФИО преподавателя) (Подпись


Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов.

Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. РЕКОМБИНАЦИЯ Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. Пути рекомбинации: - обмен клеточными ядрами - обмен целыми


''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г.

''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г. п/п ''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г. КАЛЕНДАРНО-ТЕМАТИЧЕСКИЙ ПЛАН практических занятий по дисциплине «Клиническая лабораторная диагностика: Лабораторная аналитика, Менеджмент



УЧРЕЖДЕНИЕ ВЫСШЕГО ОБРАЗОВАНИЯ РОССИЙСКИЙ УНИВЕРСИТЕТ ДРУЖБЫ НАРОДОВ. Институт биохимической технологии и нанотехнологии (ИБХТН) БИЛЕТ 1 1. История развития биотехнологии и основные ее аспекты. 2. Рекомбинантные молекулы ДНК, их получение и использование. 3. Непрерывное культивирование микроорганизмов. Хемостатный метод культивирования.





Адаптатции к наборам Парма диагностика

Адаптатции к наборам Парма диагностика АЛЬБУМИН (albumin) Код 10702-2х100 мл 1. ОБЩИЕ УКАЗАНИЯ: Альбумин реагирует с бромкрезоловым зелёным в кислой среде и образует комплекс сине-зелёного цвета, интенсивность окраски которого пропорциональна


Задача оценивания экспрессии генов по данным микрочипового анализа

Задача оценивания экспрессии генов по данным микрочипового анализа Задача оценивания экспрессии генов по данным микрочипового анализа, ВМК МГУ ММРО-15, Петрозаводск 16 сентября 2011 г. Генетика за 30 секунд ДНК молекула, содержащая всю информацию, необходимую для функционирования





И. Б. Меликсетян. Метод выявления миелиновых оболочек нервных волокон. (Представлено академиком В. В. Фанарджяном 3/VII 2001)

И. Б. Меликсетян. Метод выявления миелиновых оболочек нервных волокон. (Представлено академиком В. В. Фанарджяном 3/VII 2001) ՀԱՅԱՍՏԱՆԻ ԳԻՏՈՒԹՅՈՒՆՆԵՐԻ ԱԶԳԱՅԻՆ ԱԿԱԴԵՄԻԱ НАЦИОНАЛЬНАЯ АКАДЕМИЯ НАУК АРМЕНИИ NATIONAL ACADEMY OF SCIENCES OF ARMENIA ДОКЛАДЫ ԶԵԿՈՒՅՑՆԵՐ R E P O R T S Հատոր Том Volume 101 2001 4 УДК 616.832.611.83.004.18


Иммобилизация антител (белка) на магнитных частицах

Иммобилизация антител (белка) на магнитных частицах Иммобилизация антител (белка) на магнитных частицах Предлагаемая методика дает возможность осуществить ковалентную иммобилизацию антител или белка по Вашему выбору на поверхности магнитных частиц с силикатной


Понятие генетического полиморфизма

Понятие генетического полиморфизма Понятие генетического полиморфизма Полиморфными принято называть гены, которые представлены в популяции несколькими разновидностями - аллелями, что обусловливает разнообразие признаков внутри вида. Большинство


Молекулярная биология

Молекулярная биология Молекулярная биология Лекция 11. Разнообразие реализации природных молекул. Скоблов Михаил Юрьевич Часть 1. Межвидовое разнообразие Человек и шимпанзе Человек и шимпанзе Человек и шимпанзе Поэтому мы не


ГИПОТЕЗЫ И ФАКТЫ. А. В. ВЛАСОВ Эволюция в пробирке

ГИПОТЕЗЫ И ФАКТЫ. А. В. ВЛАСОВ Эволюция в пробирке ВЛАСОВ Александр Валентинович кандидат химических наук, научный сотрудник Института химической биологии и фундаментальной медицины СО РАН (Новосибирск) А. В. ВЛАСОВ Эволюция в пробирке Давняя мечта химиков


Десятый класс. Задача 10-1

Десятый класс. Задача 10-1 Задача 10-1 ВсОШ по химии, региональный этап Десятый класс Неизвестный газ с плотностью 1.50 г/л (н. у.) пропустили через бесцветный раствор, содержащий 1.00 г неорганической соли Х, вызывающей фиолетовое





Набор А м п л и ф и к а ц и я ДНК

Набор А м п л и ф и к а ц и я ДНК 1 1997-2010 ЗАО "Силекс " тел.: (495) 998 42 88 тел.: (495) 737 42 24 факс: (495) 737 42 24 Эл.почта: info@sileks.com Интернет: www.sileks.com Набор А м п л и ф и к а ц и я ДНК Состав набора: 1. Реакционный


Репликация у бактерий

Репликация у бактерий Репликация у бактерий 1. Содержание курса Цель данного курса познакомить студентов с цитологией, биохимией, молекулярной биологией. Рис. 1: Репликационная вилка Молекулярная биология уровень, находящийся


Методические указания к практическим занятиям для студентов

Методические указания к практическим занятиям для студентов ГБОУ ВПО Уральская Государственная медицинская академия Министерства здравоохранения Российской Федерации Кафедра микробиологии, вирусологии и иммунологии Методические указания к практическим занятиям


Генетическая инженерия

Генетическая инженерия *Генная Инженерия Генетическая инженерия Генетическая инженерия (генная инженерия) совокупность приёмов, методов и технологий получения рекомбинантных РНК и ДНК, выделения генов из организма (клеток),





Дальтон единица измерения массы вещества, равная 1,661 x г, используемая для измерения массы вирусов, клеток, хромосом, митохондрий, рибосом, а

Дальтон единица измерения массы вещества, равная 1,661 x г, используемая для измерения массы вирусов, клеток, хромосом, митохондрий, рибосом, а Д Дальтон единица измерения массы вещества, равная 1,661 x 10 24 г, используемая для измерения массы вирусов, клеток, хромосом, митохондрий, рибосом, а также молекул ДНК, РНК и белков. Дарвинизм теория,


Разработка биочипа для диагностики сифилиса путем одновременного определения антител к кардиолипину и специфическим антигенам T.

Разработка биочипа для диагностики сифилиса путем одновременного определения антител к кардиолипину и специфическим антигенам T. ФГБУ «ГНЦДК» Минздрава России Разработка биочипа для диагностики сифилиса путем одновременного определения антител к кардиолипину и специфическим антигенам T. pallidum А.А. Кубанова, А.А. Кубанов, Н.В.



ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ОБЩАЯ ФАРМАКОПЕЙНАЯ СТАТЬЯ Определение сахаров спектрофотометрическим методом ОФС. Вводится впервые Для определения сахаров используют спектрофотометрический


Колонки для эксклюзионной хроматографии Agilent AdvanceBio SEC для анализа агрегации: совместимость с приборами

Колонки для эксклюзионной хроматографии Agilent AdvanceBio SEC для анализа агрегации: совместимость с приборами Колонки для эксклюзионной хроматографии Agilent AdvanceBio SEC для анализа агрегации: совместимость с приборами Обзор технической информации Введение Колонки Agilent AdvanceBio SEC это новое семейство


Маркеры длин ДНК. Маркеры длин ДНК 100 п.н. Удобный визуальный ориентир на агарозных гелях. Информация для заказа маркера длин ДНК 100 п.н.

Маркеры длин ДНК. Маркеры длин ДНК 100 п.н. Удобный визуальный ориентир на агарозных гелях. Информация для заказа маркера длин ДНК 100 п.н. Маркеры длин ДНК Мы предоставляем широкий спектр маркеров и стандартов ДНК для точного определения длины и веса (количественного анализа) фрагментов ДНК. ДНК маркеры и стандарты позволяют определить размеры
