Диагноcтирование злокачественных опухолей у детей в 21-ом веке

Save this PDF as:
 WORD  PNG  TXT  JPG

Размер: px
Начинать показ со страницы:

Download "Диагноcтирование злокачественных опухолей у детей в 21-ом веке"

Транскрипт

1 Диагноcтирование злокачественных опухолей у детей в 21-ом веке Методы диагностики злокачественных опухолей детского возраста Определяемые диагностические характеристики Световая микроскопия (все еще остается первичным стандартом) Электронная микроскопия (используется все меньше и меньше) Иммуногистохимия (на сегодняшний день второй стандарт) Цитогенетика Молекулярная диагностика (значение ее повышается) Jesse J. Jenkins, III, M.D. Director of Pathology for the International Outreach Program St. Jude Children s esearch Hospital 2 МОЛЕКУЛЯРНО-БИОЛОГИЧЕСКИЕ МЕТОДЫ ИССЛЕДОВАНИЯ Саутерн блоттинг очищенная геномная ДНК Нортерн блоттинг РНК Вестерн блоттинг белок 3 МОЛЕКУЛЯРНО-БИОЛОГИЧЕСКИЕ МЕТОДЫ ИССЛЕДОВАНИЯ ДНК Саусерн блоттинг in situ гибридизация (ISH) Полимеразная цепная реакция (PC) мрнк Нозерн блоттинг обратная транскриптаза (T-PC) Белок Вестерн блоттинг 4 T-PC исследование Больные острым лимфобластным лейкозом (ОЛЛ) распределение по группам риска Хронический миелоидный лейкоз (ХМЛ) и ОЛЛ тип BC-ABL, являющиеся результатом транслокации t(9;22) E2A/PBX является результатом транслокации t(1;19) MLL/AF-4 является результатом транслокации t(4;11) TEL/AML1 является результатом транслокации t(12;21) Больные острым миелоидным лейкозом (AML) распределение по группам риска и лечение, направленное на специфическое генетическое повреждение PML/A-a является результатом транслокации t(15;17) AML1/ETO является результатом транслокации t(8;21) CBF-b/MYH11 является результатом инверсии inv(16) T-PC исследование Больные Цель диагностики PAX3/FKH является результатом транслокации t(2;13) в альвеолярной рабдомиосаркоме PAX7/FKH является результатом транслокации t(1;13) в альвеолярной рабдомиосаркоме EWS/EG является результатом транслокации t(11;22) в саркоме Юинга EWS/FLI1 является результатом транслокации t(21;22) в саркоме Юинга EWS/WT-1 является результатом транслокации t(11;22) в десмопластической мелко-круглоклеточной опухоли (DSCT) SYT/SSX является результатом транслокации t(x;18) в синовиальной саркоме NPM/ALK является результатом транслокации t(2;5) в анапластической крупноклеточной лимфоме 11q23 Тест MLL/AF-9 является результатом транслокации t(9;11) MLL/AF-10 является результатом транслокации t(10;11) MLL/ENL является результатом транслокации t(11;19) MLL/AF-9 является результатом транслокации t(9;11) 5 MLL/ELL является результатом транслокации t(11;19) 6

2 A Цикл #1 DNA Denature 94 o C B Cycle #1 Гибридизированная мембрана с радиоактивной пробой Anneal primers Primers Cycle #2 C. Detection Агарозный гель - + P1 P2 P3 P4 Перенос на мембрану и гибридизация с радиоактивной пробой Cycle #3 Окрашивание бромистым этидием UV-визуализация 7 8 Polymerization = eporter = uencher Strand Displacement Cleavage Polymerization Completed 9 10 Вариабельные повторяющиеся нуклеотидные регионы (VN) (для оценки статуса приживления) Реципиент 1 st allele ggcgcatcatcatcataacgagc 2 nd allele ggcgcatcatcatcatcatcatcatcatcataacgagc Донор 1 st allele ggcgcatcatcatcatcatcataacgagc nd allele ggcgcatcatcatcatcatcatcatcataacgagc 11 12

3 ecipient-pre ecipient-post (0%) ecipient-post (50% ) ecipient-post (100% ) VN Флуоресцентный Слэб Гель Реципиент 2-й аллели Донор 2-й аллели Донор 1-й аллели Реципиент 1-й аллели VN Слэб (Slab) Гель Электрофорез Pt Pre 13 Pt Post 14 VN Флуоресцентный Слэб Гель VN Capillary Gel Electrophoresis (fluorescent products run in a capillary tube) uantitative!! VN электрофорез в капиллярном геле (флюоресцентные продукты проходят в капиллярной пробирке) Возможность количественной оценки!! Реципиент до Донор Pt Pre (0% Донор) (50% Донор) Pt Post 15 (100% Донор) 16 VN Capillary Gel Electrophoresis (can distinguish down to single base pair difference) uantitative!! Patient#4- Pre Patient#4- Pre for Patient#4 for Patient#4 Microchip Arrays Метод Микрочипов (десятки тысяч генов) Олигонуклеотиды или ДНК-копии (cdna) Patient#4- Post Post VN электрофорез в капиллярном геле (может определить отличия в одной паре оснований) Возможность количественной оценки!! 17 На плотной основе т.е. на стекле или мембране 18

4 Олигонуклеотидный генный чип Компьютерный анализ Diagnostic ALL BM samples (n=327) cdna Microchip Array Green = on ed = off Метод микрочипов с использов. ДНК-копий Genes for class distinction (n=271) Зеленый = обнаружен Красный = отсутствует E2A- MLL T-ALL Hyperdiploid >50 BC- Novel PBX1 ABL -3σ -2σ -1σ 0 1σ 2σ 3σ σ = std deviation from mean TEL-AML1 19 Yeoh et al. Cancer Cell (2002) 1(2): Fluorescent In-Situ Hybridization (FISH) Nmyc Amplification Амплификация Nmyc Норма Флуоресцентная In-Situ гибридизация (FISH) EWS/FLI-1 Fusion 1p/19q Combined Deletion Комбинированная делеция 1p/19q Слияние EWS/FLI

5 Jesse J. Jenkins, III, M.D. Department of Pathology St. Jude Children s esearch Hospital 332 North Lauderdale Street Memphis, Tennessee USA Phone: (901) Fax: (901) Web site: 25

Диагностические методы исследования

Диагностические методы исследования Мелко-кругло кругло-темноклеточные опухоли в детском возрасте Дифференциальный диагноз мелкокругло-темноклеточных опухолей у детей Jesse J. Jenkins, III, M.D. Director of Pathology for the International

Подробнее

Гибридизация нуклеиновых кислот

Гибридизация нуклеиновых кислот Гибридизация нуклеиновых кислот Гибридизация нуклеиновых кислот T m температура плавления Методы, основанные на гибридизации нуклеиновых кислот Хорошо охарактеризованная ДНК или олигонуклеотидные фрагменты

Подробнее

СОЛИДНЫЕ ОПУХОЛИ ДЕТСКОГО ВОЗРАСТА

СОЛИДНЫЕ ОПУХОЛИ ДЕТСКОГО ВОЗРАСТА СОЛИДНЫЕ ОПУХОЛИ ДЕТСКОГО ВОЗРАСТА хромосомы 22q12 (транслокации: t(11;22), t(21;22), t(7;22), t(17;22), t(2;22)) генетических перестроек хромосомы 22q12); химерных транскриптов: EWS-FLI1, EWS-ERG, EWS-FEV,

Подробнее

Глава VI. B-клеточны е неоплазии.

Глава VI. B-клеточны е неоплазии. Глава VI. B-клеточны е неоплазии. 1. Неоплазии B-клеточных предшественников. 2. Неоплазии зрелых B-клеток. 3. В-клеточные пролиферативные процессы с неясным потенциалом злокачественности. 1. Неоплазии

Подробнее

МЕТОДЫ АНАЛИЗА ГЕНОВ

МЕТОДЫ АНАЛИЗА ГЕНОВ 12 МЕТОДЫ АНАЛИЗА ГЕНОВ Гены являются молекулярным субстратом наследственности. Структура и локализация генов в геноме определяет свойства организма. При функционировании генома и в результате взаимодействия

Подробнее

МОЛЕКУЛЯРНО- ГЕНЕТИЧЕСКИЙ МЕТОД

МОЛЕКУЛЯРНО- ГЕНЕТИЧЕСКИЙ МЕТОД P A R T N E R ' S P R E S E N T A T I O N МОЛЕКУЛЯРНО- ГЕНЕТИЧЕСКИЙ МЕТОД Вороная Ю.М 1мед 1группа S E C T I O N F O U R МОЛЕКУЛЯРНО - ГЕНЕТИЧЕСКИЕ МЕТОДЫ Большая и разнообразная группа методов, предназначенная

Подробнее

Опухоли мягких тканей. помимо рабдомиосаркомы. рабдомиосаркому) и герминогенные опухоли в детском возрасте

Опухоли мягких тканей. помимо рабдомиосаркомы. рабдомиосаркому) и герминогенные опухоли в детском возрасте Саркомы мягких тканей (исключая рабдомиосаркому) и герминогенные опухоли в детском возрасте помимо рабдомиосаркомы Jesse J. Jenkins, III, M.D. Director of Pathology for the International Outreach Program

Подробнее

Молекулярная диагностика онкогематологических заболеваний. Филатова Людмила Менеджер по продукции К.б.н

Молекулярная диагностика онкогематологических заболеваний. Филатова Людмила Менеджер по продукции К.б.н Молекулярная диагностика онкогематологических заболеваний Филатова Людмила Менеджер по продукции К.б.н Сравнительные характеристики методик Метод Морфология FISH Проточная цитофлуориметри я ОТ-ПЦР (транслокации)

Подробнее

Координация различных методов генетического анализа в клинической практике

Координация различных методов генетического анализа в клинической практике Координация различных методов генетического анализа в клинической практике Д.б.н. Стрельников Владимир Викторович Зав. лаб. эпигенетики ФГБНУ "МГНЦ" Проф., кафедра молекулярной и клеточной генетики РНИМУ

Подробнее

Глава 11 Методы анализа генов

Глава 11 Методы анализа генов Глава 11 Методы анализа генов 1. CS Ферменты рестрикции: a) используются в ПЦР; b) узнают одноцепочечную ДНК; c) узнают и разрезают специфические двуцепочечные последовательности ДНК; d) встречаются у

Подробнее

JAK2 BCR-ABL Mbcr RUNX1-RUNX1T1 MPL W515L/K. ETV6-RUNX1 CBFβ-MYH11 PML-RARa BAALC CLLU1 NPM1 MN1 WT1.

JAK2 BCR-ABL Mbcr RUNX1-RUNX1T1 MPL W515L/K. ETV6-RUNX1 CBFβ-MYH11 PML-RARa BAALC CLLU1 NPM1 MN1 WT1. Выявление мутаций в онкогенах Компания «ИнтерЛабСервис» предлагает уникальные наборы реагентов Ipsogen (QIAGEN) для диагностики лейкемии, в том числе редких форм, и миелопролиферативных неоплазм методом

Подробнее

Методы молекулярной диагностики в гематологии

Методы молекулярной диагностики в гематологии Методы молекулярной диагностики в гематологии А.В. Мисюрин Введение. Методы молекулярной диагностики в гематологии и трансфузиологии применяются для выявления причины патологического состояния, установления

Подробнее

Острая миелоидная лейкемия

Острая миелоидная лейкемия Глава 5. Острая миелоидная лейкемия (ОМЛ). 1. Острая миелоидная лейкемия с рекуррентными цитогенетическими аномалиями. 2. Острая миелоидная лейкемия с мультилинеарной дисплазией. 3. Острая миелоидная лейкемия

Подробнее

Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ. ЗАО «БиоХимМак»

Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ. ЗАО «БиоХимМак» Использование наборов компании Asuragen (США) для молекулярного мониторинга BCR-ABL1 при ХМЛ ЗАО «БиоХимМак» Хронический миелолейкоз (ХМЛ) Филадельфийская хромосома представляет собой генетическую аномалию,

Подробнее

АНАЛИЗ КОМПЛЕКСНЫХ ХРОМОСОМНЫХ НАРУШЕНИЙ В ГРУППЕ БОЛЬНЫХ ОСТРЫМИ ЛЕЙКОЗАМИ

АНАЛИЗ КОМПЛЕКСНЫХ ХРОМОСОМНЫХ НАРУШЕНИЙ В ГРУППЕ БОЛЬНЫХ ОСТРЫМИ ЛЕЙКОЗАМИ 3-2015 г. 14.00.00 Медицинские науки (14.01.00 Клиническая медицина) УДК 616.155.392-036.11:575.224.23 АНАЛИЗ КОМПЛЕКСНЫХ ХРОМОСОМНЫХ НАРУШЕНИЙ В ГРУППЕ БОЛЬНЫХ ОСТРЫМИ ЛЕЙКОЗАМИ Р. В. Тарновский 1, Т.

Подробнее

BlueGnome Микрочиповые CGH технологии для преимплантационного скрининга. Турленко Анна, к.б.н., Специалист по продукции

BlueGnome Микрочиповые CGH технологии для преимплантационного скрининга. Турленко Анна, к.б.н., Специалист по продукции BlueGnome Микрочиповые CGH технологии для преимплантационного скрининга Турленко Анна, к.б.н., Специалист по продукции Актуальность Сегодня проблема бесплодия одна из самых актуальнейших во многих странах

Подробнее

Методы изучения РНК. Изучение регуляторных участков ДНК. Прикладное применение NGS

Методы изучения РНК. Изучение регуляторных участков ДНК. Прикладное применение NGS Методы изучения РНК. Изучение регуляторных участков ДНК. Прикладное применение NGS 1. Молекулярные методы Анализ РНК можно проводить по следующим категориям: первичная структура (последовательность нуклеотидов),

Подробнее

Оглавление. Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11

Оглавление. Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11 Предисловие редакторов перевода...5 Предисловие редакторов шестого издания...7 Авторы...9 Принятые сокращения... 11 Глава 1. Теоретические основы биохимического анализа...13 (разд. 1.7 в соавторстве с

Подробнее

Паспорт фонда оценочных средств

Паспорт фонда оценочных средств Паспорт фонда оценочных средств п/п 1. 1.1 1.2 2. 2.1 2.2 Контролируемые разделы (темы) дисциплины* Генетика развития растений как наука. Общие принципы. Понятие о генетике развития История развития исследований

Подробнее

Биочипы. Гребенникова Т. В.

Биочипы. Гребенникова Т. В. 2.3.5.3. Биочипы Гребенникова Т. В. Биологические микрочипы (biochips) или, как их чаще называют DNA microarrays, это один из новейших инструментов биологии и медицины 21 века. В настоящее время они активно

Подробнее

Докладчик главный врач Орлова Наталья Ивановна

Докладчик главный врач Орлова Наталья Ивановна Опыт централизации лабораторных исследований при онкогематологической патологии на базе бюджетного учреждения здравоохранения Омской области «Клинический диагностический центр». Комплексный подход к диагностике

Подробнее

УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г.

УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г. УТВЕРЖДАЮ Зав. кафедрой молекулярной биологии и генетики, д.м.н. Топорков А.В. протокол 1 от «28» августа 2015 г. Календарно - тематический план лекций по дисциплине «Методы и объекты генетического анализа»

Подробнее

Маркеры длин ДНК. Маркеры длин ДНК 100 п.н. Удобный визуальный ориентир на агарозных гелях. Информация для заказа маркера длин ДНК 100 п.н.

Маркеры длин ДНК. Маркеры длин ДНК 100 п.н. Удобный визуальный ориентир на агарозных гелях. Информация для заказа маркера длин ДНК 100 п.н. Маркеры длин ДНК Мы предоставляем широкий спектр маркеров и стандартов ДНК для точного определения длины и веса (количественного анализа) фрагментов ДНК. ДНК маркеры и стандарты позволяют определить размеры

Подробнее

Основы генной инженерии и биотехнологии

Основы генной инженерии и биотехнологии Основы генной инженерии и биотехнологии Лекция 4 Анализ геномов и экспрессии генов на уровне транскрипции На предыдущих лекциях мы научились Выделять нуклеиновые кислоты и клонировать их с помощью ПЦР

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Заместитель министра Главный государственный санитарный врач О.В.Арнаутов 24 декабря 2010 г. Регистрационный 096-0710 МОЛЕКУЛЯРНЫЙ МЕТОД ОПРЕДЕЛЕНИЯ

Подробнее

Полимеразная Цепная Реакция (ПЦР)

Полимеразная Цепная Реакция (ПЦР) Полимеразная Цепная Реакция (ПЦР) (Многократное копирование специфического фрагмента НК с последующей их детекцией.) Высокая чувствительность при высокой специфичности анализа. Раннее выявление возбудителя

Подробнее

Числовые аномалии хромосом человека (анеуплоидии)

Числовые аномалии хромосом человека (анеуплоидии) Ò. Â. Îñàä óê, Ê. À. Ìîññý ÈÑÑËÅÄÎÂÀÍÈÅ ÂÛÑÎÊÎÈÍÔÎÐÌÀÒÈÂÍÛÕ ÄÍÊ-ÌÀÐÊÅÐÎÂ ÄËß ÄÈÀÃÍÎÑÒÈÊÈ ÈÑËÎÂÛÕ ÀÍÎÌÀËÈÉ ÕÐÎÌÎÑÎÌ ÅËÎÂÅÊÀ ÃÓ «Ðåñïóáëèêàíñêèé íàó íî-ïðàêòè åñêèé öåíòð «Ìàòü è äèòÿ»» èñëîâûå àíîìàëèè

Подробнее

Методы исследования нуклеиновых кислот. I. Гибридизация

Методы исследования нуклеиновых кислот. I. Гибридизация Методы исследования нуклеиновых кислот I. Гибридизация Что можно исследовать? Первичная последовательность НК Одна из фундаментальных задач молекулярной биологии и биохимии Определенные мутации Пренатальная

Подробнее

''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г.

''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г. п/п ''Утверждаю'' И.о. зав.кафедрой А.Т.Яковлев «30» августа 2016 г. КАЛЕНДАРНО-ТЕМАТИЧЕСКИЙ ПЛАН практических занятий по дисциплине «Клиническая лабораторная диагностика: Лабораторная аналитика, Менеджмент

Подробнее

УК-2 Способность проектировать и осуществлять комплексные исследования, в том числе междисциплинарные, на основе целостного системного научного мирово

УК-2 Способность проектировать и осуществлять комплексные исследования, в том числе междисциплинарные, на основе целостного системного научного мирово 1 УК-2 Способность проектировать и осуществлять комплексные исследования, в том числе междисциплинарные, на основе целостного системного научного мировоззрения с использованием знаний в области истории

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра Д.Л. Пиневич 30.09.2011 г. Регистрационный 064-0611 МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ДИАГНОСТИКА МУТАЦИЙ В ОНКОГЕНЕ BRCA1

Подробнее

Кафедра медицинской генетики СУСПИЦЫН ЕВГЕНИЙ НИКОЛАЕВИЧ ПРИМЕНЕНИЕ МЕТОДОВ МОЛЕКУЛЯРНОЙ ДИАГНОСТИКИ В КЛИНИЧЕСКОЙ ПРАКТИКЕ

Кафедра медицинской генетики СУСПИЦЫН ЕВГЕНИЙ НИКОЛАЕВИЧ ПРИМЕНЕНИЕ МЕТОДОВ МОЛЕКУЛЯРНОЙ ДИАГНОСТИКИ В КЛИНИЧЕСКОЙ ПРАКТИКЕ Государственное бюджетное образовательное учреждение высшего профессионального образования «Санкт-Петербургский государственный педиатрический медицинский университет» Министерства здравоохранения Российской

Подробнее

ОКО (отрицательный контрольный образец) для исключения ложноположительных результатов;

ОКО (отрицательный контрольный образец) для исключения ложноположительных результатов; СРАВНИТЕЛЬНЫЙ АНАЛИЗ РАСПРОСТРАНЕННОСТИ РАЗЛИЧНЫХ ВИДОВ МИКОПЛАЗМ Г.П. Погосян, А.А. Коновалова, В.В. Акимова Карагандинский Государственный Университет имени академика Е.А. Букетова Караганда, Казахстан

Подробнее

Методы работы с ДНК. ПЦР Рестрикция

Методы работы с ДНК. ПЦР Рестрикция Методы работы с ДНК ПЦР Рестрикция Рестрикция ДНК - Разрезание молекулы ДНК в определенной последовательности Рестриктазы 1. Узнают определенные последовательности в ДНК 2. Разрезают молекулу ДНК в определенных

Подробнее

Молекулярная биология

Молекулярная биология Молекулярная биология Лекция 13. Молекулярно-биологические методы. Марахонов Андрей Владимирович Место молекулярной биологии RNA Central dogma of molecular biology Этапы любого анализа Выделение того или

Подробнее

Минздравсоцразвития России, Москва. помощи детям ДЗ г. Москвы, Москва

Минздравсоцразвития России, Москва. помощи детям ДЗ г. Москвы, Москва Высокочувствительные методы анализа мутаций в биологических образцах онкологических больных для неинвазивного мониторинга заболевания: состояние проблемы, опыт и перспективы 1 ФГУ «ФНКЦ ДГОИ» Минздравсоцразвития

Подробнее

О пользовании компьютерным компакт-диском (CD-ROM)

О пользовании компьютерным компакт-диском (CD-ROM) О пользовании компьютерным компакт-диском (CD-ROM) Ассоциация медицинской помощи жертвам атомной бомбардировки («хибакуся») в Нагасаки (NASHIM) была учреждена в 1992 г. с целью продвижения медицинской

Подробнее

Микроядерный тест. Метафазный анализ, который используется при учете хромосомных аберраций в соматических клетках животных и человека, требует много

Микроядерный тест. Метафазный анализ, который используется при учете хромосомных аберраций в соматических клетках животных и человека, требует много Микроядерный тест Метафазный анализ, который используется при учете хромосомных аберраций в соматических клетках животных и человека, требует много времени и высокой квалификации исследователя. Поиск новых

Подробнее

Современная диагностика лейкемий

Современная диагностика лейкемий Современная диагностика лейкемий (в том числе радиационны х) Нанао Камада Заслуженны й профессор Университета Хиросимы Ассоциация медицинской помощи жертвам атомной бомбардировки («хибакуся») в Нагасаки

Подробнее

1. Аналитический обзор современной научно-технической, нормативной, методической литературы.

1. Аналитический обзор современной научно-технической, нормативной, методической литературы. В ходе выполнения проекта по Соглашению о предоставлении субсидии от от 22 августа 2014 г. 14.604.21.0119 с Минобрнауки России в рамках федеральной целевой программы «Исследования и разработки по приоритетным

Подробнее

«МОЛЕКУЛЯРНАЯ БИОЛОГИЯ»

«МОЛЕКУЛЯРНАЯ БИОЛОГИЯ» ДОПОЛНИТЕЛЬНАЯ ОБЩЕОБРАЗОВАТЕЛЬНАЯ (ОБЩЕРАЗВИВАЮЩАЯ) ПРОГРАММА «МОЛЕКУЛЯРНАЯ БИОЛОГИЯ» Направленность: естественнонаучная Уровень программы - базовый Возраст обучающихся - 15-18 лет Срок реализации программы

Подробнее

Получение и анализ мутаций, затрагивающих второй интрон гена Trithorax-like Drosophila melanogaster

Получение и анализ мутаций, затрагивающих второй интрон гена Trithorax-like Drosophila melanogaster УЧРЕЖДЕНИЕ РОССИЙСКОЙ АКАДЕМИИ НАУК ИНСТИТУТ ЦИТОЛОГИИ И ГЕНЕТИКИ СИБИРСКОГО ОТДЕЛЕНИЯ РАН Федорова Е.В. Получение и анализ мутаций, затрагивающих второй интрон гена Trithorax-like Drosophila melanogaster

Подробнее

Методы исследования нуклеиновых кислот

Методы исследования нуклеиновых кислот Методы исследования нуклеиновых кислот Что можно исследовать? Первичная последовательность НК Одна из фундаментальных задач молекулярной биологии и биохимии Определенные мутации Пренатальная диагностика

Подробнее

Образовательная программа послевузовского профессионального образования врачей по специальности «Клиническая лабораторная диагностика» (интернатура)

Образовательная программа послевузовского профессионального образования врачей по специальности «Клиническая лабораторная диагностика» (интернатура) Образовательная программа послевузовского профессионального образования врачей по специальности «Клиническая лабораторная диагностика» (интернатура) 1. Цель и задачи изучения раздела. Аннотация к разделу

Подробнее

Новые высокоэффективные маркеры рака мочевого пузыря

Новые высокоэффективные маркеры рака мочевого пузыря Учреждение Российской академии наук Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАН (ИБХ) Новые высокоэффективные маркеры рака мочевого пузыря Буздин Антон Александрович,

Подробнее

ДНК-макроматрицы и транскрипционное профилирование

ДНК-макроматрицы и транскрипционное профилирование БИОНАНОТЕХНОЛОГИИ Ю.Копа, К.Момыналиев ДНК-макроматрицы и транскрипционное профилирование Современные ДНК-матрицы являются высокочувствительным и точным аналитическим инструментом для научного исследования

Подробнее

Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия

Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия Исследование костного мозга в онкологии 1928г. пункция грудины 1945 г. пункция подвздошной кости 1956 г. трепанобиопсия Исследование аспирата Забор в пробирку с ЭДТА 2 мл Приготовление мазков, подсчет

Подробнее

Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014

Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014 Диагностика ВГЦ Денис Годлевский Баку, Декабрь 2014 Виды диагностики Лабораторная Экспресс-диагностика Темы Антитела/ Неструктурные белки Полимеразная цепная реакция (ПЦР) Генотипирование Фибросканирование

Подробнее

Антенатальная гибель плода:

Антенатальная гибель плода: Антенатальная гибель плода: полногеномный CNV- анализ ДНК из срезов архивных тканей плаценты и пупочной вены и клинико-морфологические корреляции Stillbirth: Genome-wide copy number variation profiling

Подробнее

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак»

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Готовые решения для лабораторной диагностики молекулярными методами Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Исследование фрагментов нуклеиновых кислот (ДНК или РНК) Основные этапы: В клетке

Подробнее

Инфекции органов репродукции. грамотная диагностика = эффективное лечение

Инфекции органов репродукции. грамотная диагностика = эффективное лечение Инфекции органов репродукции грамотная диагностика = эффективное лечение О чем эта презентация? 1. Преаналитический этап ПЦР-диагностики. Диагностика начинается в кабинете врача. 2. ПЦР как метод лабораторной

Подробнее

QIAxcel Advanced. Капиллярный электрофорез для анализа фрагментов ДНК, РНК и белков

QIAxcel Advanced. Капиллярный электрофорез для анализа фрагментов ДНК, РНК и белков QIAxcel Advanced Капиллярный электрофорез для анализа фрагментов ДНК, РНК и белков Анализ фрагментов ДНК, РНК и белков Система QIAxcel Advanced полностью заменяет традиционный анализ ДНК, РНК и белков

Подробнее

Генетика человека Медицинская генетика

Генетика человека Медицинская генетика Генетика человека Медицинская генетика Особенности генетики человека. Небольшое потомство, медленная смена поколений. Методы: 1. Не применим гибридологический метод 2. Ограниченное применение экспериментальных

Подробнее

Х РОМОСОМНЫЙ МИКРОМАТРИЧНЫЙ А НАЛИЗ

Х РОМОСОМНЫЙ МИКРОМАТРИЧНЫЙ А НАЛИЗ Х РОМОСОМНЫЙ МИКРОМАТРИЧНЫЙ А НАЛИЗ в диагностике геномных и хромосомных аномалий И.В. Канивец врач-генетик, н.с. ФГБНУ "МГНЦ" Лекция прочитана в рамках проекта genschool.ru, октябрь 2016 г. СИНДРОМ -?

Подробнее

Изотермическая амплификация ДНК. Воронина Е.Н.

Изотермическая амплификация ДНК. Воронина Е.Н. Изотермическая амплификация ДНК Воронина Е.Н. Найти иголку в стоге сена Нам нужно найти участок ДНК размером 300 нуклеотидов Разница в 30 000 000 раз В человеческом геноме размером 3 миллиарда нуклеотидов

Подробнее

Острые лейкозы: диагностика, классификация 1

Острые лейкозы: диагностика, классификация 1 Острые лейкозы: диагностика, классификация 1 Острые лейкозы представляют собой гетерогенную группу опухолевых заболеваний системы крови гемобластозов. Они характеризуются поражением костного мозга морфологически

Подробнее

Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015

Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015 Новые молекулярно-генетические технологии в лабораторной практике. Дьявол прячется в деталях. Филатова Людмила К.б.н. Владивосток, РАМЛД, 2015 Процедура Идеальная процедура анализа в анализа в молекулярной

Подробнее

Белорусский государственный университет

Белорусский государственный университет Белорусский государственный университет Генная инженерия Учебная программа (рабочий вариант) по специальности: 1-31 01 01 Биология (по направлениям) направление 1-31 01 01-03 Биология (биотехнология) Факультет

Подробнее

Системы Fludigm для проведения высокопроизводительного ПЦР

Системы Fludigm для проведения высокопроизводительного ПЦР Системы Fludigm для проведения высокопроизводительного ПЦР Системы Fludigm для проведения высокопроизводительного ПЦР Платформа Fluidigm работает на основе инновационной технологии, которая значительно

Подробнее

70-я Международная научно-практическая конференция студентов и молодых учёных "Актуальные проблемы современной медицины и фармации "

70-я Международная научно-практическая конференция студентов и молодых учёных Актуальные проблемы современной медицины и фармации А. И. Мурадханов СИНДРОМ ПРАДЕРА-ВИЛЛИ Научный руководитель канд. мед. наук, доц. Л. М. Сычик Кафедра биологии, Белорусский государственный медицинский университет, г. Минск Резюме. При изучении генетических

Подробнее

РАЗДЕЛ II ГЕННАЯ ИНЖЕНЕРИЯ ОСНОВНЫЕ ТЕОРЕТИЧЕСКИЕ ПОЛОЖЕНИЯ

РАЗДЕЛ II ГЕННАЯ ИНЖЕНЕРИЯ ОСНОВНЫЕ ТЕОРЕТИЧЕСКИЕ ПОЛОЖЕНИЯ РАЗДЕЛ II ГЕННАЯ ИНЖЕНЕРИЯ ОСНОВНЫЕ ТЕОРЕТИЧЕСКИЕ ПОЛОЖЕНИЯ Генная инженерия это отрасль молекулярной биологии и генетики, целью которой является получение с помощью лабораторных приемов организмов с новыми,

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ ИММУНОГИСТОХИМИЧЕСКИЕ МЕТОДЫ ОПРЕДЕЛЕНИЯ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ ПРИ РАКЕ МОЛОЧНОЙ ЖЕЛЕЗЫ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ ИММУНОГИСТОХИМИЧЕСКИЕ МЕТОДЫ ОПРЕДЕЛЕНИЯ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ ПРИ РАКЕ МОЛОЧНОЙ ЖЕЛЕЗЫ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра Р.А. Часнойть 05.03. 2009 г. Регистрационный 134-1108 ИММУНОГИСТОХИМИЧЕСКИЕ МЕТОДЫ ОПРЕДЕЛЕНИЯ ПРОГНОСТИЧЕСКИХ ФАКТОРОВ

Подробнее

Наследственная предрасположенность к раку молочной железы

Наследственная предрасположенность к раку молочной железы Наследственная предрасположенность к раку молочной железы М.Ю. Мандельштам ФГБУ Институт экспериментальной медицины СЗО РАМН, Санкт-Петербург Рак молочной железы часто встречающаяся онкопатология 10% женщин

Подробнее

ИЗМЕНЕНИЕ N 1 ГОСТ Р БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ.

ИЗМЕНЕНИЕ N 1 ГОСТ Р БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ. Утверждено и введено в действие Приказом Федерального агентства по техническому регулированию и метрологии от 25 декабря 2008 г. N 731-ст Дата введения - 1 июля 2009 года ИЗМЕНЕНИЕ N 1 ГОСТ Р 52174-2003.

Подробнее

Полимеразная цепная реакция (ПЦР).

Полимеразная цепная реакция (ПЦР). 2.3.5.1. Полимеразная цепная реакция (ПЦР). Гребенникова Т. В. Внедрение метода ПЦР в лабораторную практику стало одним из наиболее важных событий в биологии и медицине. Метод ПЦР позволяет определять

Подробнее

ɟ ɢɡɞɚɧɢɟ ɷɥɟɤɬɪɨɧɧɨɟ. 2013

ɟ ɢɡɞɚɧɢɟ ɷɥɟɤɬɪɨɧɧɨɟ. 2013 -... 4. 2013 УДК 577.21 ББК 28.04 П11 Авторы: Д. В. Ребриков, Г. А. Саматов, Д. Ю. Трофимов, П. А. Семёнов, А.М.Савилова, И.А.Кофиади, Д.Д.Абрамов Под общей редакцией Д. В. Ребрикова П11 ПЦР в реальном

Подробнее

ОПТИМИЗАЦИЯ ПРОТОКОЛА ЭКО-ПГС ПРИ ПОЛНОМ СКРИНИНГЕ АНЕУПЛОИДИЙ МЕТОДОМ FISH. Ладыгина В.В., Чистяков В.В. ММЦ «Private Clinic Almaty»

ОПТИМИЗАЦИЯ ПРОТОКОЛА ЭКО-ПГС ПРИ ПОЛНОМ СКРИНИНГЕ АНЕУПЛОИДИЙ МЕТОДОМ FISH. Ладыгина В.В., Чистяков В.В. ММЦ «Private Clinic Almaty» ОПТИМИЗАЦИЯ ПРОТОКОЛА ЭКО-ПГС ПРИ ПОЛНОМ СКРИНИНГЕ АНЕУПЛОИДИЙ МЕТОДОМ FISH Ладыгина В.В., Чистяков В.В. ММЦ «Private Clinic Almaty» Современный подход к ЭКО: Одна стимуляция Один эмбрион на перенос Один

Подробнее

Неинвазивное пренатальное тестирование (НИПТ) основанное на Одно- Нуклеотидных Полиморфизмах (ОНП)

Неинвазивное пренатальное тестирование (НИПТ) основанное на Одно- Нуклеотидных Полиморфизмах (ОНП) Неинвазивное пренатальное тестирование (НИПТ) основанное на Одно- Нуклеотидных Полиморфизмах (ОНП) Внеклеточная ДНК (cfdna) внк ДНК происходит из апоптотических клеток, получаемых из: Крови матери Адипоциты

Подробнее

СИНТЕЗ ОЛИГОНУКЛЕОТИДОВ

СИНТЕЗ ОЛИГОНУКЛЕОТИДОВ СИНТЕЗ ОЛИГОНУКЛЕОТИДОВ СИНТЕЗ ОЛИГОНУКЛЕОТИДОВ Олигонуклеотиды представляют собой фрагменты одноцепочечной нуклеиновой кислоты (ДНК или РНК), состоящие из небольшого количества остатков нуклеотидов, соединённых

Подробнее

Специальные предложения конца года. от Вашего партнера по биомедицинским технологиям

Специальные предложения конца года. от Вашего партнера по биомедицинским технологиям Специальные предложения конца года от Вашего партнера по биомедицинским технологиям Электрофорез и блоттинг Белковые стандарты Precision Plus Protein Экономия 30% Приобретайте белковые стандарты с выгодой

Подробнее

Мутационная изменчивость

Мутационная изменчивость Мутационная изменчивость Классификация мутаций по характеру изменения генетического материала генные (точковые). хромосомные (нарушение структуры хромосом). геномные (изменения числа хромосом или числа

Подробнее

ИНФОРМИРОВАННОЕ СОГЛАСИЕ НА ОКАЗАНИЕ УСЛУГ ПО ПРЕИМПЛАНТАЦИОННОЙ ГЕНЕТИЧЕСКОЙ ДИАГНОСТИКЕ ЭМБРИОНОВ (ПГД)

ИНФОРМИРОВАННОЕ СОГЛАСИЕ НА ОКАЗАНИЕ УСЛУГ ПО ПРЕИМПЛАНТАЦИОННОЙ ГЕНЕТИЧЕСКОЙ ДИАГНОСТИКЕ ЭМБРИОНОВ (ПГД) ИНФОРМИРОВАННОЕ СОГЛАСИЕ НА ОКАЗАНИЕ УСЛУГ ПО ПРЕИМПЛАНТАЦИОННОЙ ГЕНЕТИЧЕСКОЙ ДИАГНОСТИКЕ ЭМБРИОНОВ (ПГД) Настоящее добровольное согласие составлено в соответствии Федеральным законом РФ об основах охраны

Подробнее

К. П. Афанасьева, М. В. Александрова, И. Д. Александров МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ИССЛЕДОВАНИЯ ПО РАДИАЦИОННОЙ ГЕНЕТИКЕ DROSOPHILA В ОИЯИ

К. П. Афанасьева, М. В. Александрова, И. Д. Александров МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ИССЛЕДОВАНИЯ ПО РАДИАЦИОННОЙ ГЕНЕТИКЕ DROSOPHILA В ОИЯИ УДК: 575.224.22 К. П. Афанасьева, М. В. Александрова, И. Д. Александров Объединенный институт ядерных исследований, г. Дубна, Россия МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ ИССЛЕДОВАНИЯ ПО РАДИАЦИОННОЙ ГЕНЕТИКЕ DROSOPHILA

Подробнее

Система визуализации Gel Doc EZ

Система визуализации Gel Doc EZ Визуализация и электрофорез Система визуализации Gel Doc EZ Сократите время исследований: визуализируйте результаты за 10 секунд! ready imaging fault Визуализация EZ... Выберите трей и получите результаты

Подробнее

Определение В-клеточной клональности методом ПЦР: какой электрофоретический метод лучше? Гематологический Научный Центр РАМН

Определение В-клеточной клональности методом ПЦР: какой электрофоретический метод лучше? Гематологический Научный Центр РАМН 1 Определение В-клеточной клональности методом ПЦР: какой электрофоретический метод лучше? Сидорова Ю.В., Никитин Е.А., Рыжикова Н.В., Судариков А.Б. Гематологический Научный Центр РАМН Гематологический

Подробнее

«Автоматизация процесса пробоподготовки в ПЦР анализе»

«Автоматизация процесса пробоподготовки в ПЦР анализе» «Автоматизация процесса пробоподготовки в ПЦР анализе» Яцун Екатерина «Актуальные проблемы современной лабораторной диагностики» г. Барнаул, июнь 2010 г. Полимеразная цепная реакция (ПЦР): общие принципы

Подробнее

Проблема поражения костного мозга при солидных опухолях у детей

Проблема поражения костного мозга при солидных опухолях у детей Проблема поражения костного мозга при солидных опухолях у детей НИИ ДОГ ФГБУ «РОНЦ им. Н.Н. Блохина» академик РАН, профессор В.Г. Поляков научный сотрудник к м н Т.В. Горбунова Структура злокачественных

Подробнее

Шахгильдян В.И., Шипулина О.Ю., Сафонова А.П., Долгова Е.А., Шипулин. ФГУН Центральный НИИ эпидемиологии, Роспотребнадзора, Москва, Россия

Шахгильдян В.И., Шипулина О.Ю., Сафонова А.П., Долгова Е.А., Шипулин. ФГУН Центральный НИИ эпидемиологии, Роспотребнадзора, Москва, Россия КЛИНИЧЕСКАЯ ИНТЕРПРИТАЦИЯ МОЛЕКУЛЯРНЫХ МЕТОДОВ В ДИАГНОСТИКЕ ЦИТОМЕГАЛОВИРУСНОЙ ИНФЕКЦИИ 161 Шахгильдян В.И., Шипулина О.Ю., Сафонова А.П., Долгова Е.А., Шипулин Г.А. ФГУН Центральный НИИ эпидемиологии,

Подробнее

ПЦР в реальном времени

ПЦР в реальном времени ПЦР в реальном времени Одним из самых современных вариантов ПЦР является ПЦР в реальном времени(3). Название отражает общий смысл новой модификации. ПЦР в реальном времени основана на количественной детекции

Подробнее

АЛГОРИТМ ЛАБОРАТОРНЫХ ИССЛЕДОВАНИЙ И СОВРЕМЕННЫЕ МЕТОДЫ ВЫЯВЛЕНИЯ HPV ИНФЕКЦИИ В ПРОФИЛАКТИКЕ РАКА ШЕЙКИ МАТКИ

АЛГОРИТМ ЛАБОРАТОРНЫХ ИССЛЕДОВАНИЙ И СОВРЕМЕННЫЕ МЕТОДЫ ВЫЯВЛЕНИЯ HPV ИНФЕКЦИИ В ПРОФИЛАКТИКЕ РАКА ШЕЙКИ МАТКИ АЛГОРИТМ ЛАБОРАТОРНЫХ ИССЛЕДОВАНИЙ И СОВРЕМЕННЫЕ МЕТОДЫ ВЫЯВЛЕНИЯ HPV ИНФЕКЦИИ В ПРОФИЛАКТИКЕ РАКА ШЕЙКИ МАТКИ Сапрыгин Д.Б Российская Ассоциация медицинской лабораторной диагностики «Юнимед Лабораториз»

Подробнее

HPV-КВАНТ. Выявление, типирование и количественное определение вирусов папилломы человека

HPV-КВАНТ. Выявление, типирование и количественное определение вирусов папилломы человека HPV-КВАНТ Выявление, типирование и количественное определение вирусов папилломы человека HPV-КВАНТ НАБОР РЕАГЕНТОВ ДЛЯ ВЫЯВЛЕНИЯ, ТИПИРОВАНИЯ И КОЛИЧЕСТВЕННОГО ОПРЕДЕЛЕНИЯ ВИРУСА ПАПИЛЛОМЫ ЧЕЛОВЕКА МЕТОДОМ

Подробнее

Александр Вячеславович Качан, доцент кафедры молекулярной биологии Белорусского государственного университета, кандидат биологических наук

Александр Вячеславович Качан, доцент кафедры молекулярной биологии Белорусского государственного университета, кандидат биологических наук Учебная программа составлена на основе ОСВО 1-31 01 01-2013, ОСВО 1-31 01 03-2013, типовой учебной программы ГЕННАЯ ИНЖЕНЕ- РИЯ. ТД-G. 531/тип. 2015 г. и учебных планов УВО G31-129/уч. 2013 г., G31-131/уч.

Подробнее

«МОЛЕКУЛЯРНАЯ БИОТЕХНОЛОГИЯ С ОСНОВАМИ ГЕННОЙ ИНЖЕНЕРИИ»

«МОЛЕКУЛЯРНАЯ БИОТЕХНОЛОГИЯ С ОСНОВАМИ ГЕННОЙ ИНЖЕНЕРИИ» МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВПО «УЛЬЯНОВСКАЯ ГСХА им. П.А.Столыпина» Факультет ветеринарной медицины Кафедра биологии, ветеринарной генетики, паразитологии и экологии РАБОЧАЯ

Подробнее

Понятие генетического полиморфизма

Понятие генетического полиморфизма Понятие генетического полиморфизма Полиморфными принято называть гены, которые представлены в популяции несколькими разновидностями - аллелями, что обусловливает разнообразие признаков внутри вида. Большинство

Подробнее

Для обнаружения источника опухоли

Для обнаружения источника опухоли ONCOTEST Новейшая диагностика Для обнаружения источника опухоли 2 Компания Oncotest-TEVA обеспечивает комплексный и всесторонний подход к диагностике раковых заболеваний благодаря использованию многочисленных

Подробнее

ВИРУС ИММУНОДЕФИЦИТА ЧЕЛОВЕКА СПИД

ВИРУС ИММУНОДЕФИЦИТА ЧЕЛОВЕКА СПИД ВИРУС ИММУНОДЕФИЦИТА Алмаз Шарман ЧЕЛОВЕКА СПИД СИНДРОМ ПРИОБРЕТЕННОГО ИММУНОДЕФИЦИТА Эпидемиология, молекулярно-клеточные аспекты, принципы диагностики, терапии, профилактики ВИЧ-инфекции и синдрома приобретенного

Подробнее

Факультет «Клиническая психология Дисциплина «Генетика человека» Занятие 6.

Факультет «Клиническая психология Дисциплина «Генетика человека» Занятие 6. Занятие 6. Изменчивость и ее значение в онтогенезе человека. Фенотипическая и генотипическая изменчивость. Генный, хромосомный и геномный уровни нарушения генетического аппарата. Генные болезни как результат

Подробнее

Геном. Плазмиды Вирусы Митохондрии и Хлоропласты

Геном. Плазмиды Вирусы Митохондрии и Хлоропласты Лекция 10 Геном Плазмиды - 10 3-10 4 Вирусы - 10 3-10 4 Митохондрии и Хлоропласты - 10 4-10 5 ПРОКАРИОТЫ -10 5-10 6 ЭУКАРИОТЫ Дрожжи - 10 7 Животные - 10 8-10 9 Растения - 10 9-10 11 Лекция 9 2 500 знаков/стр,

Подробнее

4. Перечень разделов и (или) тем дисциплины и их дидактическое содержание. История развития биотехнологии и ОПК-11,

4. Перечень разделов и (или) тем дисциплины и их дидактическое содержание. История развития биотехнологии и ОПК-11, 1. Целью изучения дисциплины является: ознакомление студентов с современным состоянием медицинской биотехнологии; формирование у студентов системных знаний по фундаментальным понятиям биомедицинской науки;

Подробнее

Encyclo Plus PCR kit

Encyclo Plus PCR kit Encyclo Plus PCR kit Набор реактивов Номер по каталогу PK101 Инструкция по применению Набор реактивов Encyclo Plus PCR kit предназначен только для исследовательских работ, выполняемых профессионально подготовленными

Подробнее

О.В. Трофимов ГЕНЕТИЧЕСКАЯ ИНЖЕНЕРИЯ

О.В. Трофимов ГЕНЕТИЧЕСКАЯ ИНЖЕНЕРИЯ 2 МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «ТЮМЕНСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ» Институт

Подробнее

Нормальное функционирование клетки обеспечивается сложным ансамблем последовательных

Нормальное функционирование клетки обеспечивается сложным ансамблем последовательных Мультиплексный анализ Нормальное функционирование клетки обеспечивается сложным ансамблем последовательных ферментативных реакций, запускаемых после взаимодействия вне- и внутриклеточных рецепторов с разнообразными

Подробнее

Молекулярно-генетические методы в диагностике перинатальных инфекций

Молекулярно-генетические методы в диагностике перинатальных инфекций Молекулярно-генетические методы в диагностике перинатальных инфекций Кафарская Л.И., Ефимов Б.А., Шкопоров А.Н. Работа выполнена при финансовой поддержке Минобразования и науки Перинатальные инфекции Успешная

Подробнее

ОЛЛ модель. Лимфоматозный менингит: модель детского ОЛЛ. Поражение центральной нервной системы у детей с ОЛЛ. John T. Sandlund, M.D.

ОЛЛ модель. Лимфоматозный менингит: модель детского ОЛЛ. Поражение центральной нервной системы у детей с ОЛЛ. John T. Sandlund, M.D. ОЛЛ модель модель детского ОЛЛ John T. Sandlund, M.D. Определение поражения ЦНС и оценка ЦНСстатуса Значение интенсифицированного лечения и профилактики ЦНС-поражения 2 Поражение центральной нервной системы

Подробнее

ГЕНЕТИКА ОСТРЫХ ЛЕЙКОЗОВ У ДЕТЕЙ ПЕРВОГО ГОДА ЖИЗНИ

ГЕНЕТИКА ОСТРЫХ ЛЕЙКОЗОВ У ДЕТЕЙ ПЕРВОГО ГОДА ЖИЗНИ ГЕНЕТИКА ОСТРЫХ ЛЕЙКОЗОВ У ДЕТЕЙ ПЕРВОГО ГОДА ЖИЗНИ Цаур Григорий Анатольевич, к.м.н. Областная детская клиническая больница 1 Институт медицинских клеточных технологий г. Екатеринбург VI Съезде детских

Подробнее

I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5

I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 содержание I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 II. СОРБЕНТНЫЙ МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект

Подробнее

Паспорт фонда оценочных средств

Паспорт фонда оценочных средств 1 Паспорт фонда оценочных средств п/п Контролируемые разделы дисциплины Код контролируемой компетенции (или ее части) 1 Основы цитогенетики ВПК-1, ПК-20 2 Методы получения и анализа препаратов хромосом

Подробнее

Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов.

Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. Генетическая рекомбинация - это перераспределение генетического материала (ДНК), приводящее к возникновению новых комбинаций генов. Рекомбинация может происходить путем обмена клеточными ядрами, целыми

Подробнее

Введение в молекулярную биологию (для информатиков) Александр Предеус Институт биоинформатики

Введение в молекулярную биологию (для информатиков) Александр Предеус Институт биоинформатики Введение в молекулярную биологию (для информатиков) Александр Предеус Институт биоинформатики Урок 1.1 Основные концепции молекулярной биологии молекулы, составляющие клетку биополимеры: ДНК, РНК, протеины

Подробнее