«Автоматизация процесса пробоподготовки в ПЦР анализе»

Размер: px
Начинать показ со страницы:

Download "«Автоматизация процесса пробоподготовки в ПЦР анализе»"


1 «Автоматизация процесса пробоподготовки в ПЦР анализе» Яцун Екатерина «Актуальные проблемы современной лабораторной диагностики» г. Барнаул, июнь 2010 г.

2 Полимеразная цепная реакция (ПЦР): общие принципы ЦР - метод молекулярной диагностики, позволяющий интезировать специфический фрагмент нуклеиновой кислоты (ДНК) з биологического материала in vitro. етод широко используется в медицинской практике для иагностики заболеваний (наследственных, инфекционных и др.). 2

3 ПЦР в клинической диагностике: качественные методы: безопасность переливания крови диагностика инфекционных заболеваний контроль излеченности генотипирование определение мутаций количественные методы: определение вирусных нагрузок оценка терапевтического эффекта прогноз эффективности терапии определение устойчивости 3

4 ПЦР: СХЕМА Компоненты, необходимые для проведения ПЦР: ДНК-матрица, содержащая участок ДНК для амплификации два праймера термостабильная ДНК-полимераза нуклеотиды 5 - GTTGAGACCAGTAGTCGATCAAGCACCGATGGCCAGTGAT TACCGGTAACGATGCAGCATT CAACTCTGGTCATCAGCTAGTTCGTGGCTACCGGTAACGA ACATGCGTTGAGGCCAGTA-3 4

5 ПЦР: СХЕМА денатурация ДНК отжиг: связь праймеров и матрицы элонгация: синтез второй цепи 1 цикл закончен 2 цикл- последующее удвоение 5

6 ПЦР как диагностический метод: многоэтапность, трудозатраты забор пробы преаналитическая стадия пробоподготовка приготовление образца: плазма крови соскоб мокрота АНАЛИЗ экстракция целевой ДНК: много манипуляций временной фактор 6

7 Этапы пробоподготовки в ручном варианте на примере метода магнитной сепарации отбор первичного образца добавление лизирующего раствора с магнитным сорбентом высокотемп. лизис и гибридизация сбор осадка TECAN FREEDOM EVO отбор перенос элюата надосадочной в реакционную смесь трехкратная жидкости промывка 7

8 Автоматизация пробоподготовки для ПЦР: TECAN ECAN FREEDOM EVO 8

9 Автоматизация ПЦР Сложности, связанные с автоматизацией пробоподготовки методов для выделения НК 1. Отсутствие возможности использования стадии центрифугирования, или существенное уменьшение числа анализируемых образцов 1. Сложность контроля методов выделения, основанных на мембранной фильтрации 2. Требование к предельному сокращению числа стадий протокола 3. Помехоустойчивость протокола, связанная с ограничением возможностей контроля и изменения протокола станцией пробоподготовки 4. Сужение спектра пригодных для использования реагентов, допустимых действий и перечня расходных материалов 9

10 Автоматизация ПЦР Преимущества автоматизации пробоподготовки ПЦР Существенное увеличение производительности лаборатории Сведение к минимуму влияния человеческого фактора, строгая детерминация стадий протокола Снижение риска контаминации лаборатории Упрощение и повышение надежности процедуры анализа результатов за счет автоматизации процесса штрих-кодирования и отслеживания каждого этапа протокола Сокращение времени для внедрения новых тест-систем Использование магнитного сорбента в протоколе выделение ДНК позволяет полностью автоматизировать пробоподготовку, делая ПЦР- анализ простым и надежным 10

11 FREEDOM EVO: : особенности и преимущества Открытая система: возможность работы с большинством наборов для выделения нуклеиновых кислот с помощью магнитных частиц, как отечественного, так и зарубежного производства Широкие возможности создания различных конфигураций под конкретные задачи Возможность интеграции оборудования TECAN и других производителей Одноразовые наконечники с фильтром, для дополнительной защиты от контаминации Возможность создания «пулов» образцов с дальнейшим выделением нуклеиновых кислот Система штрих-кодирования для контроля нахождения каждого образца на всех этапах пробоподготовки 11

12 Freedom EVO 12

13 Freedom EVO 13

14 Freedom EVO EVO 200/8 Эксплуатационные показатели EVO 75/2 EVO 100/4/8 EVO 150/4/8 Минимальная Малая Средняя Высокая Производительность 14

15 TECAN: : высокие технологии и надежность Определение уровня жидкости и осадка посредством токопроводящих наконечников позволяет контролировать процессирование каждого образца на каждой стадии протокола Идентификация по штрих-коду с помощью Сканера PosID : штативы образцы ёмкости с реагентами микропланшеты глубокодонные планшеты 15

16 TECAN: : высокие технологии и надежность Использование дозирующих шприцев: - от 10мкл до 5мл при использовании стационарных наконечников - от 10нл до 1мл при использовании одноразовых наконечников Модуль TeMags позволяет легко и эффективно автоматизировать метод выделения нуклеиновых кислот - управляемый магнит - термостат для пробирок объема 1,5мл 16

17 TECAN: открытость и совместимость Развитие сотрудничества с производителями приборов ПЦР и наборов для выделения нуклеиновых кислот Станции пробоподготовки ПЦР Freedom EVO: Applied Biosystems Bio-Rad ДНК-технология Вектор-Бест Интерлабсервис Биоком 17



XIRIL. Neon 100 АВТОМАТИЗАЦИЯ ПЦР-ДИАГНОСТИКИ XIRIL Neon 100 АВТОМАТИЗАЦИЯ ПЦР-ДИАГНОСТИКИ Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР Высокая производительность Обработка от 1 до 96 образцов одновременно Продолжительность


«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г.

«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г. «Использования технологий TECAN в автоматизации NAT-тестирования Яцун Екатерина г. Ростов-на-Дону, 13-14 октября 2010 г. Актуальность В Европе с 1999 года ПЦР обязательный метод для тестирования всей донорской


Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР

Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР www.interlabservice.ru Высокая производительность Обработка от 1 до 96 образцов одновременно Продолжительность высококачественного


I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5

I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 содержание I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 II. СОРБЕНТНЫЙ МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект


Платформа Freedom EVO cвобода для развития

Платформа Freedom EVO cвобода для развития Платформа Freedom EVO cвобода для развития Использование автоматизированных систем диагностики (TECAN) для скрининговых исследований животных и растений на наличие инфекционных и вирусологических патогенов


быстро обнаружить - успешно вылечить!

быстро обнаружить - успешно вылечить! ФГБУ Центральный НИИ туберкулёза РАМН быстро обнаружить - успешно вылечить! Технология «Амплитуб» быстрая диагностика туберкулёза определение лекарственной устойчивости к препаратам I и II ряда автоматизация


Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР

Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР TECAN Group Ltd. Один из мировых лидеров в производстве автоматизированных решений для клиникодиагностических, фармацевтических и научно-исследовательских


Комплексы КДЛ. Новый уровень качества автоматизации процессов в ПЦР-лаборатории

Комплексы КДЛ. Новый уровень качества автоматизации процессов в ПЦР-лаборатории Комплексы КДЛ Новый уровень качества автоматизации процессов в ПЦР-лаборатории Комплекс «КДЛ-ПРАЙМ» это компактное решение, которое позволяет контролировать движение в процессе исследования и автоматизировать


Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека

Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека (количественный) Вир-10-100, на 100 реакций 1 Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание...


Автоматизация ПЦР-диагностики для службы крови. Комплексные предложения для автоматизации ПЦР-скрининга донорской крови

Автоматизация ПЦР-диагностики для службы крови. Комплексные предложения для автоматизации ПЦР-скрининга донорской крови Автоматизация ПЦР-диагностики для службы крови Комплексные предложения для автоматизации ПЦР-скрининга донорской крови Программно-аппаратные комплексы ИЛС для безопасности донорства это СПК-премиум СПК-стандарт


Набор для определения мутации L138 в гене CFTR

Набор для определения мутации L138 в гене CFTR Набор для определения мутации L138 в гене CFTR Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание... 4 Необходимое оборудование... 4 Важные замечания... 5 Меры предосторожности...


Универсальное предложение для клинических лабораторий. Комплекс КДЛ-МАКС. Система автоматизации ПЦР-лабораторий

Универсальное предложение для клинических лабораторий. Комплекс КДЛ-МАКС. Система автоматизации ПЦР-лабораторий Универсальное предложение для клинических лабораторий Комплекс КДЛ-МАКС Система автоматизации ПЦР-лабораторий Компания ИнтерЛабСервис более 10 лет является лидером в области молекулярной диагностики. Возрастающий



ИНСТРУКЦИЯ. «МАГНО-сорб» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК/ДНК из клинического материала «МАГНО-сорб» АмплиСенс Федеральное бюджетное учреждение науки «Центральный научно-исследовательский институт


Молекулярная диагностика возбудителей заболеваний картофеля

Молекулярная диагностика возбудителей заболеваний картофеля Молекулярная диагностика возбудителей заболеваний картофеля Владимир Карандашов, к.б.н. Руководитель лаборатории диагностики фитопатогенов ООО «Исследовательский центр «ФитоИнженерия» Московская область,


Набор для выявления вируса болезни Ньюкасла

Набор для выявления вируса болезни Ньюкасла Набор для выявления вируса болезни Ньюкасла (количественный) Вир-8-100, на 100 реакций 1 Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание... 4 Меры предосторожности... 4



ИНСТРУКЦИЯ VIBRIO СHOLERAE ИНСТРУКЦИЯ по применению комплекта реагентов для проведения ПЦРамплификации ДНК токсигенных штаммов холерного вибриона VIBRIO СHOLERAE ВНИМАНИЕ! Vibrio cholerae относится ко II группе патогенности. Все


Гелевая технология для иммуногематологических исследований

Гелевая технология для иммуногематологических исследований Гелевая технология для иммуногематологических исследований Задачи лабораторной службы в иммуногематологии Принятие в РФ нового технического регламента иммуногематологического обследования доноров (Постановления


Проблема. В основе молекулярно-генетических методов исследования лежит метод ПЦР, позволяющий амплифицировать нужный регион ДНК.

Проблема. В основе молекулярно-генетических методов исследования лежит метод ПЦР, позволяющий амплифицировать нужный регион ДНК. Автоматизация полного цикла молекулярно-генетической диагностики туберкулеза и определения лекарственной устойчивости МБТ на основе ПЦР в реальном времени Аляпкина Ю.С. 1, Смирнова Т.Г. 3, Варламов Д.А.


ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ

ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ ИНСТРУКЦИЯ по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ Регистрационное удостоверение МЗ СР РФ ФСР 2010/08412 ВНИМАНИЕ! Изучите инструкцию


Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени

Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени н аучн о- п р оизвод с т венная ком пани я Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени Те х н о л о г и я «А М П Л И Т У Б» 1 нь де Скорость Безопасность Высокая достоверность





Автоматические системы биобанкинга и управления биологическими образцами Hamilton

Автоматические системы биобанкинга и управления биологическими образцами Hamilton Автоматические системы биобанкинга и управления биологическими образцами Hamilton 2 www.interlabservice.ru Биобанк от Hamilton уверенность в сохранности вашей коллекции биологических образцов Единые стандарты


Обработка клинического материала и выделение нуклеиновых кислот

Обработка клинического материала и выделение нуклеиновых кислот Обработка клинического материала и выделение нуклеиновых кислот первый и важнейший этап молекулярно-биологического исследования. Основной задачей данного этапа является получение очищенного препарата ДНК


Автоматизированная пробоподготовка

Автоматизированная пробоподготовка Автоматизированная пробоподготовка Системы для выделения и очистки нуклеиновых кислот Пробоподготовка остается одним из наиболее нестабильных и трудоемких этапов ПЦР, поэтому Roche Applied Science разработала



ИНСТРУКЦИЯ ГЕПАТОГЕН-Б КОЛИЧЕСТВЕННЫЙ ИНСТРУКЦИЯ по применению набора реагентов для количественного определения ДНК вируса гепатита Б (HBV) методом полимеразной цепной реакции (ПЦР) ГЕПАТОГЕН-Б КОЛИЧЕСТВЕННЫЙ Регистрационное удостоверение


ИНСТРУКЦИЯ. по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени

ИНСТРУКЦИЯ. по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени ИНСТРУКЦИЯ по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени ООО «Биологическая среда», Российская Федерация, 127015, город Москва, улица Большая Новодмитровская



ИНСТРУКЦИЯ ОТ ГЕПАТОГЕН С ГЕНОТИП ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гепатита С (HСV) и его генотипирования методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ОТ ГЕПАТОГЕН С ГЕНОТИП Регистрационное


Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови»

Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови» Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови» Проект Национальные дни лабораторной медицины России - 2013 Национальные стандарты лабораторной диагностики ГОСТ Р ИСО 15195-2006



ИНСТРУКЦИЯ ВИЧ ГЕН КОЛИЧЕСТВЕННЫЙ ИНСТРУКЦИЯ по применению набора реагентов для количественного определения РНК вируса иммунодефицита человека (ВИЧ) методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ВИЧ ГЕН КОЛИЧЕСТВЕННЫЙ


Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак»

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Готовые решения для лабораторной диагностики молекулярными методами Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Исследование фрагментов нуклеиновых кислот (ДНК или РНК) Основные этапы: В клетке


Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени

Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени Инструкция по применению набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени (2Х премикс для ПЦР-РВ) Комплектация: Компонент На 200 реакций Объем реакции


ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК/ДНК из клинического материала. «РИБО-преп»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК/ДНК из клинического материала. «РИБО-преп» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК/ДНК из клинического материала «РИБО-преп» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект






ИНСТРУКЦИЯ. «АмплиСенс GSTT1 / GSTM1-EPh» ИНСТРУКЦИЯ по применению набора реагентов для выявления генетических полиморфизмов в генах GSTT1 и GSTM1 человека методом полимеразной цепной реакции (ПЦР) с электрофоретической детекцией продуктов амплификации


Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре

Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре Тренинг «Использование методики Xpert MTB/RIF», г.душанбе, 29 июля 2 августа 2013 г. Презентация подготовлена в рамках проекта USAID


Рекомендации по постановке ПЦР

Рекомендации по постановке ПЦР Рекомендации по постановке ПЦР К наборам реактивов ## PK101, PK121. К полимеразам ## PK002S/L, PK013, PK014, PK015, PK016, PK022, PK123S/L. К готовым смесям для ПЦР ## PK041S/L, PK143S/L, PK145S/L, PK147S/L,


Молекулярная диагностика инфекционных и инвазионных заболеваний животных.

Молекулярная диагностика инфекционных и инвазионных заболеваний животных. Молекулярная диагностика инфекционных и инвазионных заболеваний животных. д. б. н. Гребенникова Т. В. ГУ НИИ Вирусологии им. Д. И. Ивановского НПО НАРВАК Метод полимеразной цепной реакции Метод множественной


2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование

2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование 2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование регионального центра по моделированию и разработке инновационных


Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени

Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени ООО «ИнтерЛабСервис» www.interlabservice.ru Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени Дмитрий Куевда Автоматизация в диагностических


Содержание Введение Внеклеточные нуклеиновые кислоты Гены группы Rh Тест-система для идентификации ДНК плода в крови матери

Содержание Введение Внеклеточные нуклеиновые кислоты Гены группы Rh Тест-система для идентификации ДНК плода в крови матери Содержание Введение 3 Внеклеточные нуклеиновые кислоты 4 Гены группы Rh 4 Тест-система для идентификации ДНК плода в крови матери 6 Выделение циркулирующих нуклеиновых кислот 7 Рекомендуемый порядок расположения


Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии.

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии. Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии. Статистика онкологических заболеваний В настоящее время онкологические заболевания


Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М.

Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М. Ключевые методы молекулярной биологии. Секвенирование по Сенгеру Докладчик: Шадрин Д.М. 1 История разработки метода Фридрих Мишер Николай Открытие ДНК Константинович 1869 год. Кольцов Структура ДНК, 1927






ИНСТРУКЦИЯ ПРОБА-ЦТАБ ИНСТРУКЦИЯ по применению комплекта реагентов для выделения ДНК ПРОБА-ЦТАБ Выполнено в соответствии с методическими указаниями МУК 4.2.1913-04 ВНИМАНИЕ! Изучите инструкцию перед началом работы 2 1. НАЗНАЧЕНИЕ


Том I. Раздел 6. Молекулярная диагностика вирусных гепатитов



ИНСТРУКЦИЯ. «АмплиСенс МАГНО-сорб-УРО» АмплиСенс. по применению комплекта реагентов для экстракции ДНК из биологического материала

ИНСТРУКЦИЯ. «АмплиСенс МАГНО-сорб-УРО» АмплиСенс. по применению комплекта реагентов для экстракции ДНК из биологического материала ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «АмплиСенс МАГНО-сорб-УРО» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123,


ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-B»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-B» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК из клинического материала «РИБО-золь-B» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект


Автоматизация в клинической лабораторной диагностике

Автоматизация в клинической лабораторной диагностике Автоматизация в клинической лабораторной диагностике О компании TECAN Компания TECAN (Швейцария, Австрия) производит приборы и автоматизированные системы для генетических, иммунологических, микробиологических,


Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах 2

Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах 2 версия от 26 октября 2015 Sileks Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах MP@SiO 2 Cat. #: KIRUR025 Назначение набора: выделение тотальной нуклеиновой кислоты Условия


ИНФОРМАЦИОННЫЙ ЛИСТ. Дата изменения: версия 3

ИНФОРМАЦИОННЫЙ ЛИСТ. Дата изменения: версия 3 ИНФОРМАЦИОННЫЙ ЛИСТ Дата изменения: 05.10.15 версия 3 Информируем Вас о дополнениях и уточнениях в инструкции по применению набора реагентов «АмплиСенс HCV-Монитор-FL» 1. ВНИМАНИЕ! При использовании автоматической


Автоматический иммуноферментный анализатор ЧАРОИТ

Автоматический иммуноферментный анализатор ЧАРОИТ Автоматический иммуноферментный анализатор ЧАРОИТ Полностью автоматизированная платформа для проведения ИФА анализатор Чароит Чароит современный высокопроизводительный ИФА анализатор с уникальной технологией


DuPont Nutrition & Health

DuPont Nutrition & Health DuPont Nutrition & Health Система RiboPrinter для идентификации микроорганизмов ООО «НИАРМЕДИК ПЛЮС» Отдел молекулярной микробиологии RiboPrinter - система для идентификации бактерий 2 Автоматический метод


Предложения для. переливания крови. Карасев Александр

Предложения для. переливания крови. Карасев Александр Предложения для автоматизации ПЦРисследований в службе переливания крови Карасев Александр Тестирование донорской крови 2 Plasma Protein Therapeutics Association EU, USA Тестирование на патогены проводится


ИНСТРУКЦИЯ. по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L»

ИНСТРУКЦИЯ. по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L» ИНСТРУКЦИЯ по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 4 формах комплектации: Форма 1 включает комплект реагентов


ИНСТРУКЦИЯ. по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ

ИНСТРУКЦИЯ. по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ ИНСТРУКЦИЯ по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ ООО «Биологическая среда», Российская Федерация, 127015, город Москва, улица Большая Новодмитровская д. 23, стр. 3 ОГЛАВЛЕНИЕ


ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-А»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-А» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК из клинического материала «РИБО-золь-А» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект


Комплексное решение для молекулярных исследований

Комплексное решение для молекулярных исследований Комплексное решение для молекулярных исследований Ведерников Виталий Евгеньевич, к.б.н., руководитель группы ПЦР Лаборатории молекулярной диагностики ООО «Вега» ГК «Алкор Био» http://forpcr.ru Taq M Hot-Start


Предложения по ряду требований, не применимых к наборам

Предложения по ряду требований, не применимых к наборам Предложения по ряду требований, не применимых к наборам реагентов для ПЦР-диагностики ДИСКУССИОННЫЙ КЛУБ ФБГУ «ЦМИКЭЭ» Росздравнадзора и ФБГУ «ВНИИИМТ» Росздравнадзора разместили на своем сайте методические


ИНСТРУКЦИЯ. по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК»

ИНСТРУКЦИЯ. по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК» ИНСТРУКЦИЯ по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК» СОДЕРЖАНИЕ СПИСОК СОКРАЩЕНИЙ... 3 НАЗНАЧЕНИЕ... 3 ПРИНЦИП МЕТОДА... 3 МЕРЫ ПРЕДОСТОРОЖНОСТИ...


Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции

Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции Новые технологии в молекулярной диагностике инфекционных, наследственных и Филатова Людмила К.б.н Менеджер по продукции Генетические технологии не роскошь, а средство Основные направления развития диагностических


Encyclo Plus PCR kit

Encyclo Plus PCR kit Encyclo Plus PCR kit Набор реактивов Номер по каталогу PK101 Инструкция по применению Набор реактивов Encyclo Plus PCR kit предназначен только для исследовательских работ, выполняемых профессионально подготовленными


ИНСТРУКЦИЯ. по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810

ИНСТРУКЦИЯ. по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810 ИНСТРУКЦИЯ по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810 Изучите инструкцию перед началом работы 2 1. НАЗНАЧЕНИЕ Набор реагентов



ИНСТРУКЦИЯ. ИНСТРУКЦИЯ по применению набора реагентов для идентификации гена (RHD) плода в крови матери «ДНК-резус ребенка» и «ДНК-резус ребенка плюс» (варианты на 50 и 100 определений) ТУ 9398-001-64943561-2010 www.testgen.ru





Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии 09-12 октября 2015 года, Звенигород Виктория Мудрая ООО «БиоЛайн» 8 (812) 320 4949



ИНСТРУКЦИЯ СКАН ТЕРМИНАТОР NOS ИНСТРУКЦИЯ по применению набора реагентов для выявления ДНК терминатора NOS Agrobacterium tumefaciens методом полимеразной цепной реакции СКАН ТЕРМИНАТОР NOS ВНИМАНИЕ! Изучите инструкцию перед началом


Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014

Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014 Диагностика ВГЦ Денис Годлевский Баку, Декабрь 2014 Виды диагностики Лабораторная Экспресс-диагностика Темы Антитела/ Неструктурные белки Полимеразная цепная реакция (ПЦР) Генотипирование Фибросканирование


Современные технологии в комплексном оснащении цитологической лаборатории.

Современные технологии в комплексном оснащении цитологической лаборатории. Современные технологии в комплексном оснащении цитологической лаборатории. Жидкостная цитология. Иммуноцитохимия. Телепатология. 22-25 сентября 2016 года, Феодосия Виктория Мудрая ООО «БиоЛайн» 8 (812)


RapidHIT мобильная система быстрого реагирования

RapidHIT мобильная система быстрого реагирования RapidHIT мобильная система быстрого реагирования Те же методы, тот же результат, но намного проще Выделение Амплификация Фрагментный анализ Достоинства, которые не оставят Вас равнодушными к RapidHIT 3


ИНСТРУКЦИЯ. ВНИМАНИЕ! Изучите инструкцию перед началом работы

ИНСТРУКЦИЯ. ВНИМАНИЕ! Изучите инструкцию перед началом работы ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гриппа А субтипа H5N1 («птичьего гриппа») (Influenza A virus subtype H5N1) методом полимеразной цепной реакции с обратной транскрипцией


ИНСТРУКЦИЯ. по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции.

ИНСТРУКЦИЯ. по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции. ИНСТРУКЦИЯ по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции. вирус скручивания листьев картофеля, вирус метельчатости верхушки картофеля,



ВИЧ, ДНК ВИЧ, РНК ВГС, ДНК ВГВ, ДНК ЦМВ, HLA B Приложение 4 к методическим рекомендациям по диспансерному наблюдению пациентов с установленным диагнозом «ВИЧ-инфекция» Правила оформления направления, взятия и доставки образцов крови для исследований


Глава 11 Методы анализа генов

Глава 11 Методы анализа генов Глава 11 Методы анализа генов 1. CS Ферменты рестрикции: a) используются в ПЦР; b) узнают одноцепочечную ДНК; c) узнают и разрезают специфические двуцепочечные последовательности ДНК; d) встречаются у


Номера по каталогу BC35T, BC35S, BC35M, BC35L

Номера по каталогу BC35T, BC35S, BC35M, BC35L КлинМаг ДНК Набор реактивов Номера по каталогу BC35T, BC35S, BC35M, BC35L Набор для очистки ДНК на магнитных частицах Инструкция по применению Набор реактивов КлинМаг ДНК предназначен только для исследовательских


ИНСТРУКЦИЯ. «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм. по применению комплекта реагентов для экстракции ДНК из биологического материала

ИНСТРУКЦИЯ. «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм. по применению комплекта реагентов для экстракции ДНК из биологического материала ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм ООО «НекстБио», Российская Федерация, 111394, город Москва, улица Полимерная,





ООО АЛЬФАЛАБ. Рабочая инструкция

ООО АЛЬФАЛАБ. Рабочая инструкция ООО АЛЬФАЛАБ Рабочая инструкция по применению набора реагентов для обнаружения ДНК возбудителей гельминтозов (Ascaris lumbricoides, Enterobius vermicularis, Opisthorchis felineus, Taenia solium, Diphyllobothrium


Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин

Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин Болаева Кермен, к.б.н., специалист по молекулярной биологии 27 октября 2015 Производство





Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР. Гапонов А. М., Тутельян А. В. г. Москва

Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР. Гапонов А. М., Тутельян А. В. г. Москва Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР Гапонов А. М., Тутельян А. В. г. Москва Схема эксперимента В работе использовались диагностические наборы для PCR


«Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы»

«Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы» Научно-образовательный форум «Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы» Петров Олег Павлович Специалист отдела вакуумных систем г. Симферополь,



ИНСТРУКЦИЯ ОТ-ГЕПАТОГЕН-С ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гепатита С (HСV) методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ОТ-ГЕПАТОГЕН-С Регистрационное удостоверение МЗ


ИНСТРУКЦИЯ. «РНК вируса гепатита С»

ИНСТРУКЦИЯ. «РНК вируса гепатита С» ИНСТРУКЦИЯ по применению панели контрольных образцов «РНК вируса гепатита С» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город Москва, улица Новогиреевская, дом 3а



МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Заместитель министра здравоохранения Главный государственный санитарный врач Республики Беларусь О.В. Арнаутов 11 апреля 2011 г. Регистрационный






ИНСТРУКЦИЯ «РЕВЕРТАЗА» ИНСТРУКЦИЯ по применению комплекта реагентов «РЕВЕРТАЗА» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город Москва, улица Новогиреевская, дом 3а Только для исследовательских


Программно-аппаратный комплекс для лабораторий молекулярной диагностики

Программно-аппаратный комплекс для лабораторий молекулярной диагностики Программно-аппаратный комплекс для лабораторий молекулярной диагностики XIRIL Neon 100 Rotor-Gene Q FRT-Manager АмплиСенс Комплексное предложение для Центров по профилактике и борьбе со СПИД и инфекционными


Оснащение современной лаборатории

Оснащение современной лаборатории Современное оборудование и расходные материалы для клинических лабораторных исследований мочи В.А. Крюкова ведущий эксперт отдела преаналитики и клинической биохимии ООО ОМБ Моча является вторым по значимости


В экспериментальных работах надо сомневаться до тех пор, пока факты не заставляют отказаться от всяких сомнений.

В экспериментальных работах надо сомневаться до тех пор, пока факты не заставляют отказаться от всяких сомнений. «АЛИСА» лабораторная информационная система, которая является универсальной программой для автоматизации и оптимизации деятельности клиникодиагностической лаборатории и внутрилабораторного управления качеством.



ИНСТРУКЦИЯ НА НАБОРЫ ПО ВЫДЕЛЕНИЮ ДНК «НУКЛЕОСОРБ» ИНСТРУКЦИЯ НА НАБОРЫ ПО ВЫДЕЛЕНИЮ ДНК «НУКЛЕОСОРБ» Типы А, В, С, G, P Перечень условных обозначений, использованных в инструкции ДНК дезоксирибонуклеиновая кислота ОКО отрицательный контрольный образец


Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ

Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ Стационар на 830 коек Хирургия, гинекология травматология, кардиология, отделение рентгенхирургических методов диагностики и лечения, урология В год 3700





ИНСТРУКЦИЯ. по применению комплекта реагентов для экстракции ДНК из биологического материала

ИНСТРУКЦИЯ. по применению комплекта реагентов для экстракции ДНК из биологического материала ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «АмплиСенс ДНК-сорб-Д» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город


ИНСТРУКЦИЯ ВИЧ-ГЕН. Регистрационное удостоверение МЗ СР РФ ФСР 2008/ ВНИМАНИЕ! Изучите инструкцию перед началом работы

ИНСТРУКЦИЯ ВИЧ-ГЕН. Регистрационное удостоверение МЗ СР РФ ФСР 2008/ ВНИМАНИЕ! Изучите инструкцию перед началом работы ИНСТРУКЦИЯ по применению набора реагентов для выявления нуклеиновых кислот (НК) вируса иммунодефицита человека (ВИЧ) методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ВИЧ-ГЕН Регистрационное



ИЗМЕНЕНИЕ N 1 ГОСТ Р БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ. Утверждено и введено в действие Приказом Федерального агентства по техническому регулированию и метрологии от 25 декабря 2008 г. N 731-ст Дата введения - 1 июля 2009 года ИЗМЕНЕНИЕ N 1 ГОСТ Р 52174-2003.



ИНСТРУКЦИЯ. «ДНК-сорб-С-М» ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «ДНК-сорб-С-М» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город Москва,


MagPurix 12s. Система автоматическая для выделения нуклеиновых кислот. РУ МЗ РФ РЗН 2014/2047 от г.

MagPurix 12s. Система автоматическая для выделения нуклеиновых кислот. РУ МЗ РФ РЗН 2014/2047 от г. MagPurix 12s Система автоматическая для выделения нуклеиновых кислот РУ МЗ РФ РЗН 2014/2047 от 29.10.2014г. MagPurix 12s компактная роботизированная система для автоматического выделения нуклеиновых кислот





Решение задачи полной автоматизации иммуногематологических исследований. М.Г.Вершинина ФГБУ «ЦКБ с Поликлиникой» УД Президента РФ г.

Решение задачи полной автоматизации иммуногематологических исследований. М.Г.Вершинина ФГБУ «ЦКБ с Поликлиникой» УД Президента РФ г. Решение задачи полной автоматизации иммуногематологических исследований М.Г.Вершинина ФГБУ «ЦКБ с Поликлиникой» УД Президента РФ г. Москва Крупнейший медицинский комплекс емкостью 1200 коек.больница оказывает


Tornado Taq-полимераза (hot-start)

Tornado Taq-полимераза (hot-start) Tornado Taq-полимераза (hot-start) Tornado Taq-полимераза является уникальным ферментом, обладающим повышенной термостабильностью, устойчивостью к ингибиторам ПЦР и повышенной скоростью синтеза ДНК по
