«Автоматизация процесса пробоподготовки в ПЦР анализе»

Save this PDF as:
 WORD  PNG  TXT  JPG

Размер: px
Начинать показ со страницы:

Download "«Автоматизация процесса пробоподготовки в ПЦР анализе»"

Транскрипт

1 «Автоматизация процесса пробоподготовки в ПЦР анализе» Яцун Екатерина «Актуальные проблемы современной лабораторной диагностики» г. Барнаул, июнь 2010 г.

2 Полимеразная цепная реакция (ПЦР): общие принципы ЦР - метод молекулярной диагностики, позволяющий интезировать специфический фрагмент нуклеиновой кислоты (ДНК) з биологического материала in vitro. етод широко используется в медицинской практике для иагностики заболеваний (наследственных, инфекционных и др.). 2

3 ПЦР в клинической диагностике: качественные методы: безопасность переливания крови диагностика инфекционных заболеваний контроль излеченности генотипирование определение мутаций количественные методы: определение вирусных нагрузок оценка терапевтического эффекта прогноз эффективности терапии определение устойчивости 3

4 ПЦР: СХЕМА Компоненты, необходимые для проведения ПЦР: ДНК-матрица, содержащая участок ДНК для амплификации два праймера термостабильная ДНК-полимераза нуклеотиды 5 - GTTGAGACCAGTAGTCGATCAAGCACCGATGGCCAGTGAT TACCGGTAACGATGCAGCATT CAACTCTGGTCATCAGCTAGTTCGTGGCTACCGGTAACGA ACATGCGTTGAGGCCAGTA-3 4

5 ПЦР: СХЕМА денатурация ДНК отжиг: связь праймеров и матрицы элонгация: синтез второй цепи 1 цикл закончен 2 цикл- последующее удвоение 5

6 ПЦР как диагностический метод: многоэтапность, трудозатраты забор пробы преаналитическая стадия пробоподготовка приготовление образца: плазма крови соскоб мокрота АНАЛИЗ экстракция целевой ДНК: много манипуляций временной фактор 6

7 Этапы пробоподготовки в ручном варианте на примере метода магнитной сепарации отбор первичного образца добавление лизирующего раствора с магнитным сорбентом высокотемп. лизис и гибридизация сбор осадка TECAN FREEDOM EVO отбор перенос элюата надосадочной в реакционную смесь трехкратная жидкости промывка 7

8 Автоматизация пробоподготовки для ПЦР: TECAN ECAN FREEDOM EVO 8

9 Автоматизация ПЦР Сложности, связанные с автоматизацией пробоподготовки методов для выделения НК 1. Отсутствие возможности использования стадии центрифугирования, или существенное уменьшение числа анализируемых образцов 1. Сложность контроля методов выделения, основанных на мембранной фильтрации 2. Требование к предельному сокращению числа стадий протокола 3. Помехоустойчивость протокола, связанная с ограничением возможностей контроля и изменения протокола станцией пробоподготовки 4. Сужение спектра пригодных для использования реагентов, допустимых действий и перечня расходных материалов 9

10 Автоматизация ПЦР Преимущества автоматизации пробоподготовки ПЦР Существенное увеличение производительности лаборатории Сведение к минимуму влияния человеческого фактора, строгая детерминация стадий протокола Снижение риска контаминации лаборатории Упрощение и повышение надежности процедуры анализа результатов за счет автоматизации процесса штрих-кодирования и отслеживания каждого этапа протокола Сокращение времени для внедрения новых тест-систем Использование магнитного сорбента в протоколе выделение ДНК позволяет полностью автоматизировать пробоподготовку, делая ПЦР- анализ простым и надежным 10

11 FREEDOM EVO: : особенности и преимущества Открытая система: возможность работы с большинством наборов для выделения нуклеиновых кислот с помощью магнитных частиц, как отечественного, так и зарубежного производства Широкие возможности создания различных конфигураций под конкретные задачи Возможность интеграции оборудования TECAN и других производителей Одноразовые наконечники с фильтром, для дополнительной защиты от контаминации Возможность создания «пулов» образцов с дальнейшим выделением нуклеиновых кислот Система штрих-кодирования для контроля нахождения каждого образца на всех этапах пробоподготовки 11

12 Freedom EVO 12

13 Freedom EVO 13

14 Freedom EVO EVO 200/8 Эксплуатационные показатели EVO 75/2 EVO 100/4/8 EVO 150/4/8 Минимальная Малая Средняя Высокая Производительность 14

15 TECAN: : высокие технологии и надежность Определение уровня жидкости и осадка посредством токопроводящих наконечников позволяет контролировать процессирование каждого образца на каждой стадии протокола Идентификация по штрих-коду с помощью Сканера PosID : штативы образцы ёмкости с реагентами микропланшеты глубокодонные планшеты 15

16 TECAN: : высокие технологии и надежность Использование дозирующих шприцев: - от 10мкл до 5мл при использовании стационарных наконечников - от 10нл до 1мл при использовании одноразовых наконечников Модуль TeMags позволяет легко и эффективно автоматизировать метод выделения нуклеиновых кислот - управляемый магнит - термостат для пробирок объема 1,5мл 16

17 TECAN: открытость и совместимость Развитие сотрудничества с производителями приборов ПЦР и наборов для выделения нуклеиновых кислот Станции пробоподготовки ПЦР Freedom EVO: Applied Biosystems Bio-Rad ДНК-технология Вектор-Бест Интерлабсервис Биоком 17

18 СПАСИБО ЗА ВНИМАНИЕ!

XIRIL. Neon 100 АВТОМАТИЗАЦИЯ ПЦР-ДИАГНОСТИКИ

XIRIL. Neon 100 АВТОМАТИЗАЦИЯ ПЦР-ДИАГНОСТИКИ XIRIL Neon 100 АВТОМАТИЗАЦИЯ ПЦР-ДИАГНОСТИКИ Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР Высокая производительность Обработка от 1 до 96 образцов одновременно Продолжительность

Подробнее

«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г.

«Использования технологий TECAN в автоматизации NAT-тестирования. Яцун Екатерина г. Ростов-на-Дону, октября 2010 г. «Использования технологий TECAN в автоматизации NAT-тестирования Яцун Екатерина г. Ростов-на-Дону, 13-14 октября 2010 г. Актуальность В Европе с 1999 года ПЦР обязательный метод для тестирования всей донорской

Подробнее

Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР

Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР Полная автоматизация выделения нуклеиновых кислот и подготовки проб к ПЦР www.interlabservice.ru Высокая производительность Обработка от 1 до 96 образцов одновременно Продолжительность высококачественного

Подробнее

I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5

I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 содержание I. ЭКСПРЕСС-МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект реагентов для выделения ДНК «ПРОБА-РАПИД» 4 Комплект реагентов для выделения ДНК «ПРОБА-РАПИД-ГЕНЕТИКА» 5 II. СОРБЕНТНЫЙ МЕТОД ВЫДЕЛЕНИЯ ДНК Комплект

Подробнее

Платформа Freedom EVO cвобода для развития

Платформа Freedom EVO cвобода для развития Платформа Freedom EVO cвобода для развития Использование автоматизированных систем диагностики (TECAN) для скрининговых исследований животных и растений на наличие инфекционных и вирусологических патогенов

Подробнее

Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР

Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР Автоматизация выделения ДНК при диагностике туберкулёза методом ПЦР TECAN Group Ltd. Один из мировых лидеров в производстве автоматизированных решений для клиникодиагностических, фармацевтических и научно-исследовательских

Подробнее

быстро обнаружить - успешно вылечить!

быстро обнаружить - успешно вылечить! ФГБУ Центральный НИИ туберкулёза РАМН быстро обнаружить - успешно вылечить! Технология «Амплитуб» быстрая диагностика туберкулёза определение лекарственной устойчивости к препаратам I и II ряда автоматизация

Подробнее

Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека

Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека Набор для выявления вирусов инфекционного ларинготрахеита и болезни Марека (количественный) Вир-10-100, на 100 реакций 1 Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание...

Подробнее

Комплексы КДЛ. Новый уровень качества автоматизации процессов в ПЦР-лаборатории

Комплексы КДЛ. Новый уровень качества автоматизации процессов в ПЦР-лаборатории Комплексы КДЛ Новый уровень качества автоматизации процессов в ПЦР-лаборатории Комплекс «КДЛ-ПРАЙМ» это компактное решение, которое позволяет контролировать движение в процессе исследования и автоматизировать

Подробнее

Автоматизация ПЦР-диагностики для службы крови. Комплексные предложения для автоматизации ПЦР-скрининга донорской крови

Автоматизация ПЦР-диагностики для службы крови. Комплексные предложения для автоматизации ПЦР-скрининга донорской крови Автоматизация ПЦР-диагностики для службы крови Комплексные предложения для автоматизации ПЦР-скрининга донорской крови Программно-аппаратные комплексы ИЛС для безопасности донорства это СПК-премиум СПК-стандарт

Подробнее

Набор для определения мутации L138 в гене CFTR

Набор для определения мутации L138 в гене CFTR Набор для определения мутации L138 в гене CFTR Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание... 4 Необходимое оборудование... 4 Важные замечания... 5 Меры предосторожности...

Подробнее

Устройство и правила работы ПЦР-лаборатории Урынбаева А.А. ФГБОУ ВО Башкирский ГАУ Уфа, Россия

Устройство и правила работы ПЦР-лаборатории Урынбаева А.А. ФГБОУ ВО Башкирский ГАУ Уфа, Россия Устройство и правила работы ПЦР-лаборатории Урынбаева А.А. ФГБОУ ВО Башкирский ГАУ Уфа, Россия The device and rules of work of PTsR-laboratory Urynbayeva A.A. The Bashkir State Agrarian University Ufa,

Подробнее

Набор для выявления вируса болезни Ньюкасла

Набор для выявления вируса болезни Ньюкасла Набор для выявления вируса болезни Ньюкасла (количественный) Вир-8-100, на 100 реакций 1 Содержание Компоненты набора... 3 Область применения... 3 Гарантия... 3 Описание... 4 Меры предосторожности... 4

Подробнее

ИНСТРУКЦИЯ. «МАГНО-сорб»

ИНСТРУКЦИЯ. «МАГНО-сорб» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК/ДНК из клинического материала «МАГНО-сорб» АмплиСенс Федеральное бюджетное учреждение науки «Центральный научно-исследовательский институт

Подробнее

Универсальное предложение для клинических лабораторий. Комплекс КДЛ-МАКС. Система автоматизации ПЦР-лабораторий

Универсальное предложение для клинических лабораторий. Комплекс КДЛ-МАКС. Система автоматизации ПЦР-лабораторий Универсальное предложение для клинических лабораторий Комплекс КДЛ-МАКС Система автоматизации ПЦР-лабораторий Компания ИнтерЛабСервис более 10 лет является лидером в области молекулярной диагностики. Возрастающий

Подробнее

Молекулярная диагностика возбудителей заболеваний картофеля

Молекулярная диагностика возбудителей заболеваний картофеля Молекулярная диагностика возбудителей заболеваний картофеля Владимир Карандашов, к.б.н. Руководитель лаборатории диагностики фитопатогенов ООО «Исследовательский центр «ФитоИнженерия» Московская область,

Подробнее

ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ

ИНСТРУКЦИЯ. по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ ИНСТРУКЦИЯ по применению комплекта реагентов для ПЦР-амплификации геномной ДНК человека в режиме реального времени КВМ Регистрационное удостоверение МЗ СР РФ ФСР 2010/08412 ВНИМАНИЕ! Изучите инструкцию

Подробнее

ИНСТРУКЦИЯ VIBRIO СHOLERAE

ИНСТРУКЦИЯ VIBRIO СHOLERAE ИНСТРУКЦИЯ по применению комплекта реагентов для проведения ПЦРамплификации ДНК токсигенных штаммов холерного вибриона VIBRIO СHOLERAE ВНИМАНИЕ! Vibrio cholerae относится ко II группе патогенности. Все

Подробнее

117587, Москва, Варшавское ш., д.125ж, к.6 Тел./факс +7 (495) Е-mail: Информация о наборе

117587, Москва, Варшавское ш., д.125ж, к.6 Тел./факс +7 (495) Е-mail:  Информация о наборе Набор реагентов для выявления РНК вируса гриппа А субтипа HN1 («птичьего гриппа») (Influenza A virus subtype HN1) методом полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР) Назначение: Информация

Подробнее

Гелевая технология для иммуногематологических исследований

Гелевая технология для иммуногематологических исследований Гелевая технология для иммуногематологических исследований Задачи лабораторной службы в иммуногематологии Принятие в РФ нового технического регламента иммуногематологического обследования доноров (Постановления

Подробнее

Проблема. В основе молекулярно-генетических методов исследования лежит метод ПЦР, позволяющий амплифицировать нужный регион ДНК.

Проблема. В основе молекулярно-генетических методов исследования лежит метод ПЦР, позволяющий амплифицировать нужный регион ДНК. Автоматизация полного цикла молекулярно-генетической диагностики туберкулеза и определения лекарственной устойчивости МБТ на основе ПЦР в реальном времени Аляпкина Ю.С. 1, Смирнова Т.Г. 3, Варламов Д.А.

Подробнее

Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени

Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени н аучн о- п р оизвод с т венная ком пани я Молекулярно-генетическая диагностика туберкулёза методом ПЦР в реальном времени Те х н о л о г и я «А М П Л И Т У Б» 1 нь де Скорость Безопасность Высокая достоверность

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра Д.Л. Пиневич 30.09.2011 г. Регистрационный 064-0611 МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ДИАГНОСТИКА МУТАЦИЙ В ОНКОГЕНЕ BRCA1

Подробнее

Автоматические системы биобанкинга и управления биологическими образцами Hamilton

Автоматические системы биобанкинга и управления биологическими образцами Hamilton Автоматические системы биобанкинга и управления биологическими образцами Hamilton 2 www.interlabservice.ru Биобанк от Hamilton уверенность в сохранности вашей коллекции биологических образцов Единые стандарты

Подробнее

Автоматизированная пробоподготовка

Автоматизированная пробоподготовка Автоматизированная пробоподготовка Системы для выделения и очистки нуклеиновых кислот Пробоподготовка остается одним из наиболее нестабильных и трудоемких этапов ПЦР, поэтому Roche Applied Science разработала

Подробнее

Обработка клинического материала и выделение нуклеиновых кислот

Обработка клинического материала и выделение нуклеиновых кислот Обработка клинического материала и выделение нуклеиновых кислот первый и важнейший этап молекулярно-биологического исследования. Основной задачей данного этапа является получение очищенного препарата ДНК

Подробнее

ИНСТРУКЦИЯ ВИЧ ГЕН КОЛИЧЕСТВЕННЫЙ

ИНСТРУКЦИЯ ВИЧ ГЕН КОЛИЧЕСТВЕННЫЙ ИНСТРУКЦИЯ по применению набора реагентов для количественного определения РНК вируса иммунодефицита человека (ВИЧ) методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ВИЧ ГЕН КОЛИЧЕСТВЕННЫЙ

Подробнее

ИНСТРУКЦИЯ ГЕПАТОГЕН-Б КОЛИЧЕСТВЕННЫЙ

ИНСТРУКЦИЯ ГЕПАТОГЕН-Б КОЛИЧЕСТВЕННЫЙ ИНСТРУКЦИЯ по применению набора реагентов для количественного определения ДНК вируса гепатита Б (HBV) методом полимеразной цепной реакции (ПЦР) ГЕПАТОГЕН-Б КОЛИЧЕСТВЕННЫЙ Регистрационное удостоверение

Подробнее

ИНСТРУКЦИЯ ОТ ГЕПАТОГЕН С ГЕНОТИП

ИНСТРУКЦИЯ ОТ ГЕПАТОГЕН С ГЕНОТИП ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гепатита С (HСV) и его генотипирования методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ОТ ГЕПАТОГЕН С ГЕНОТИП Регистрационное

Подробнее

ИНСТРУКЦИЯ. по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени

ИНСТРУКЦИЯ. по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени ИНСТРУКЦИЯ по применению тест-систем для выявления инфекционных патогенов методом ПЦР в режиме реального времени ООО «Биологическая среда», Российская Федерация, 127015, город Москва, улица Большая Новодмитровская

Подробнее

Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови»

Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови» Стандартизованная технология «Определение концентрации РНК ВИЧ в плазме крови» Проект Национальные дни лабораторной медицины России - 2013 Национальные стандарты лабораторной диагностики ГОСТ Р ИСО 15195-2006

Подробнее

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак»

Готовые решения для лабораторной диагностики молекулярными методами. Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Готовые решения для лабораторной диагностики молекулярными методами Каширина Мария Молекулярный биолог ЗАО «БиоХимМак» Исследование фрагментов нуклеиновых кислот (ДНК или РНК) Основные этапы: В клетке

Подробнее

Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени

Инструкция по применению. набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени Инструкция по применению набора реагентов для проведения количественного ПЦР с детекцией результатов в режиме реального времени (2Х премикс для ПЦР-РВ) Комплектация: Компонент На 200 реакций Объем реакции

Подробнее

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК/ДНК из клинического материала. «РИБО-преп»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК/ДНК из клинического материала. «РИБО-преп» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК/ДНК из клинического материала «РИБО-преп» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект

Подробнее

Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени

Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени ООО «ИнтерЛабСервис» www.interlabservice.ru Новые программные разработки для автоматизации и рационализации диагностики методами ПЦР в режиме реального времени Дмитрий Куевда Автоматизация в диагностических

Подробнее

ПОЛ ПЛОДА ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА

ПОЛ ПЛОДА ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА ПОЛ ПЛОДА ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА НЕИНВАЗИВНАЯ ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА КОМПАНИЯ «ДНК-ТЕХНОЛОГИЯ» ПРЕДСТАВЛЯЕТ ЛИНЕЙКУ НАБОРОВ ДЛЯ НЕИНВАЗИВНОЙ ПРЕНАТАЛЬНОЙ ДИАГНОСТИКИ, ВКЛЮЧАЮЩУЮ НАБОРЫ «РЕЗУС-ФАКТОР

Подробнее

ИНСТРУКЦИЯ. «АмплиСенс GSTT1 / GSTM1-EPh»

ИНСТРУКЦИЯ. «АмплиСенс GSTT1 / GSTM1-EPh» ИНСТРУКЦИЯ по применению набора реагентов для выявления генетических полиморфизмов в генах GSTT1 и GSTM1 человека методом полимеразной цепной реакции (ПЦР) с электрофоретической детекцией продуктов амплификации

Подробнее

Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре

Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре Полимеразная цепная реакция. Принцип метода. Требования к инфраструктуре Тренинг «Использование методики Xpert MTB/RIF», г.душанбе, 29 июля 2 августа 2013 г. Презентация подготовлена в рамках проекта USAID

Подробнее

Рекомендации по постановке ПЦР

Рекомендации по постановке ПЦР Рекомендации по постановке ПЦР К наборам реактивов ## PK101, PK121. К полимеразам ## PK002S/L, PK013, PK014, PK015, PK016, PK022, PK123S/L. К готовым смесям для ПЦР ## PK041S/L, PK143S/L, PK145S/L, PK147S/L,

Подробнее

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии.

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии. Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии. Статистика онкологических заболеваний В настоящее время онкологические заболевания

Подробнее

ИНСТРУКЦИЯ ПРОБА-ЦТАБ

ИНСТРУКЦИЯ ПРОБА-ЦТАБ ИНСТРУКЦИЯ по применению комплекта реагентов для выделения ДНК ПРОБА-ЦТАБ Выполнено в соответствии с методическими указаниями МУК 4.2.1913-04 ВНИМАНИЕ! Изучите инструкцию перед началом работы 2 1. НАЗНАЧЕНИЕ

Подробнее

Набор реактивов для очистки ДНК на магнитных частицах

Набор реактивов для очистки ДНК на магнитных частицах CleanMag DNA Набор реактивов для очистки ДНК на магнитных частицах Номера по каталогу BC35T BC35S BC35M BC35L Инструкция по применению Набор реактивов CleanMag DNA предназначен только для исследовательских

Подробнее

Молекулярная диагностика инфекционных и инвазионных заболеваний животных.

Молекулярная диагностика инфекционных и инвазионных заболеваний животных. Молекулярная диагностика инфекционных и инвазионных заболеваний животных. д. б. н. Гребенникова Т. В. ГУ НИИ Вирусологии им. Д. И. Ивановского НПО НАРВАК Метод полимеразной цепной реакции Метод множественной

Подробнее

2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование

2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование 2009 год -«Липецкий медицинский колледж»- победитель в национальном проекте «Образование» с инновационной образовательной программой «Формирование регионального центра по моделированию и разработке инновационных

Подробнее

Содержание Введение Внеклеточные нуклеиновые кислоты Гены группы Rh Тест-система для идентификации ДНК плода в крови матери

Содержание Введение Внеклеточные нуклеиновые кислоты Гены группы Rh Тест-система для идентификации ДНК плода в крови матери Содержание Введение 3 Внеклеточные нуклеиновые кислоты 4 Гены группы Rh 4 Тест-система для идентификации ДНК плода в крови матери 6 Выделение циркулирующих нуклеиновых кислот 7 Рекомендуемый порядок расположения

Подробнее

НОВОСТИ ГЕМАТОЛОГИЧЕСКОГО АНАЛИЗА И ПРИБОРНОГО ОБЕСПЕЧЕНИЯ. АВТОМАТИЧЕСКИЕ СОЭ-МЕТРЫ

НОВОСТИ ГЕМАТОЛОГИЧЕСКОГО АНАЛИЗА И ПРИБОРНОГО ОБЕСПЕЧЕНИЯ. АВТОМАТИЧЕСКИЕ СОЭ-МЕТРЫ www.diesse.ru www.westmedica.com 7-8 сентября 2011 Хабаровск НОВОСТИ ГЕМАТОЛОГИЧЕСКОГО АНАЛИЗА И ПРИБОРНОГО ОБЕСПЕЧЕНИЯ. АВТОМАТИЧЕСКИЕ СОЭ-МЕТРЫ СОЭ скорость оседания эритроцитов СОЭ показатель скорости

Подробнее

Том I. Раздел 6. Молекулярная диагностика вирусных гепатитов

Том I. Раздел 6. Молекулярная диагностика вирусных гепатитов ИСПОЛЬЗОВАНИЕ ТЕСТ-СИСТЕМ «АМПЛИСЕНС HCV-1/2/3» C ДЕТЕКЦИЕЙ ПРОДУКТОВ ПЦР В РЕАЛЬНОМ ВРЕМЕНИ ДЛЯ ВЫЯВЛЕНИЯ И ГЕНОТИПИРОВАНИЯ РНК HCV В РУТИННОЙ ЛАБОРАТОРНОЙ ПРАКТИКЕ 289 Шипулина О.Ю., Гущин А.Е., Миронов

Подробнее

ИНСТРУКЦИЯ. по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L»

ИНСТРУКЦИЯ. по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L» ИНСТРУКЦИЯ по применению комплекта реагентов для получения кднк на матрице РНК «РЕВЕРТА-L» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 4 формах комплектации: Форма 1 включает комплект реагентов

Подробнее

ИНСТРУКЦИЯ. «АмплиСенс МАГНО-сорб-УРО» АмплиСенс. по применению комплекта реагентов для экстракции ДНК из биологического материала

ИНСТРУКЦИЯ. «АмплиСенс МАГНО-сорб-УРО» АмплиСенс. по применению комплекта реагентов для экстракции ДНК из биологического материала ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «АмплиСенс МАГНО-сорб-УРО» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123,

Подробнее

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-B»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-B» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК из клинического материала «РИБО-золь-B» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект

Подробнее

Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М.

Ключевые методы молекулярной биологии. Секвенирование по Сенгеру. Докладчик: Шадрин Д.М. Ключевые методы молекулярной биологии. Секвенирование по Сенгеру Докладчик: Шадрин Д.М. 1 История разработки метода Фридрих Мишер Николай Открытие ДНК Константинович 1869 год. Кольцов Структура ДНК, 1927

Подробнее

Автоматизация в клинической лабораторной диагностике

Автоматизация в клинической лабораторной диагностике Автоматизация в клинической лабораторной диагностике О компании TECAN Компания TECAN (Швейцария, Австрия) производит приборы и автоматизированные системы для генетических, иммунологических, микробиологических,

Подробнее

ИНФОРМАЦИОННЫЙ ЛИСТ. Дата изменения: версия 3

ИНФОРМАЦИОННЫЙ ЛИСТ. Дата изменения: версия 3 ИНФОРМАЦИОННЫЙ ЛИСТ Дата изменения: 05.10.15 версия 3 Информируем Вас о дополнениях и уточнениях в инструкции по применению набора реагентов «АмплиСенс HCV-Монитор-FL» 1. ВНИМАНИЕ! При использовании автоматической

Подробнее

ИНСТРУКЦИЯ. TNC Комплекс

ИНСТРУКЦИЯ. TNC Комплекс ИНСТРУКЦИЯ по применению набора реагентов для выявления ДНК Trichomonas vaginalis/neisseria gonorrhoeae/chlamydia trachomatis методом ПЦР в режиме реального времени TNC Комплекс ВНИМАНИЕ! Изучите инструкцию

Подробнее

Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах 2

Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах 2 версия от 26 октября 2015 Sileks Выделение тотальной нуклеиновой кислоты (ДНК и РНК) из мочи на магнитных частицах MP@SiO 2 Cat. #: KIRUR025 Назначение набора: выделение тотальной нуклеиновой кислоты Условия

Подробнее

Автоматический иммуноферментный анализатор ЧАРОИТ

Автоматический иммуноферментный анализатор ЧАРОИТ Автоматический иммуноферментный анализатор ЧАРОИТ Полностью автоматизированная платформа для проведения ИФА анализатор Чароит Чароит современный высокопроизводительный ИФА анализатор с уникальной технологией

Подробнее

Предложения для. переливания крови. Карасев Александр

Предложения для. переливания крови. Карасев Александр Предложения для автоматизации ПЦРисследований в службе переливания крови Карасев Александр Тестирование донорской крови 2 Plasma Protein Therapeutics Association EU, USA Тестирование на патогены проводится

Подробнее

Комплексное решение для молекулярных исследований

Комплексное решение для молекулярных исследований Комплексное решение для молекулярных исследований Ведерников Виталий Евгеньевич, к.б.н., руководитель группы ПЦР Лаборатории молекулярной диагностики ООО «Вега» ГК «Алкор Био» http://forpcr.ru Taq M Hot-Start

Подробнее

DuPont Nutrition & Health

DuPont Nutrition & Health DuPont Nutrition & Health Система RiboPrinter для идентификации микроорганизмов ООО «НИАРМЕДИК ПЛЮС» Отдел молекулярной микробиологии RiboPrinter - система для идентификации бактерий 2 Автоматический метод

Подробнее

Предложения по ряду требований, не применимых к наборам

Предложения по ряду требований, не применимых к наборам Предложения по ряду требований, не применимых к наборам реагентов для ПЦР-диагностики ДИСКУССИОННЫЙ КЛУБ ФБГУ «ЦМИКЭЭ» Росздравнадзора и ФБГУ «ВНИИИМТ» Росздравнадзора разместили на своем сайте методические

Подробнее

Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции

Новые технологии в молекулярной диагностике инфекционных, наследственных и онкологических заболеваний. Филатова Людмила К.б.н Менеджер по продукции Новые технологии в молекулярной диагностике инфекционных, наследственных и Филатова Людмила К.б.н Менеджер по продукции Генетические технологии не роскошь, а средство Основные направления развития диагностических

Подробнее

ИНСТРУКЦИЯ. по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ

ИНСТРУКЦИЯ. по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ ИНСТРУКЦИЯ по применению набора реагентов для выделения ДНК и РНК УНИВЕРСАЛЬНЫЙ ООО «Биологическая среда», Российская Федерация, 127015, город Москва, улица Большая Новодмитровская д. 23, стр. 3 ОГЛАВЛЕНИЕ

Подробнее

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-А»

ИНСТРУКЦИЯ. по применению комплекта реагентов для выделения РНК из клинического материала. «РИБО-золь-А» ИНСТРУКЦИЯ по применению комплекта реагентов для выделения РНК из клинического материала «РИБО-золь-А» ФОРМА КОМПЛЕКТАЦИИ. Комплект реагентов выпускается в 2 формах комплектации: Форма 1 включает комплект

Подробнее

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии

Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии Рациональный подход к оснащению цитологической лаборатории: от жидкостной цитологии до иммуноцитохимии и телепатологии 09-12 октября 2015 года, Звенигород Виктория Мудрая ООО «БиоЛайн» 8 (812) 320 4949

Подробнее

ИНСТРУКЦИЯ. по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК»

ИНСТРУКЦИЯ. по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК» ИНСТРУКЦИЯ по применению реагента для предобработки цельной периферической и пуповинной крови «ГЕМОЛИТИК» СОДЕРЖАНИЕ СПИСОК СОКРАЩЕНИЙ... 3 НАЗНАЧЕНИЕ... 3 ПРИНЦИП МЕТОДА... 3 МЕРЫ ПРЕДОСТОРОЖНОСТИ...

Подробнее

Современные технологии в комплексном оснащении цитологической лаборатории.

Современные технологии в комплексном оснащении цитологической лаборатории. Современные технологии в комплексном оснащении цитологической лаборатории. Жидкостная цитология. Иммуноцитохимия. Телепатология. 22-25 сентября 2016 года, Феодосия Виктория Мудрая ООО «БиоЛайн» 8 (812)

Подробнее

Encyclo Plus PCR kit

Encyclo Plus PCR kit Encyclo Plus PCR kit Набор реактивов Номер по каталогу PK101 Инструкция по применению Набор реактивов Encyclo Plus PCR kit предназначен только для исследовательских работ, выполняемых профессионально подготовленными

Подробнее

ИНСТРУКЦИЯ. по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810

ИНСТРУКЦИЯ. по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810 ИНСТРУКЦИЯ по применению набора реагентов для выявления ДНК ГМ кукурузы линии MON 810 методом полимеразной цепной реакции MON 810 Изучите инструкцию перед началом работы 2 1. НАЗНАЧЕНИЕ Набор реагентов

Подробнее

ИНСТРУКЦИЯ.

ИНСТРУКЦИЯ. ИНСТРУКЦИЯ по применению набора реагентов для идентификации гена (RHD) плода в крови матери «ДНК-резус ребенка» и «ДНК-резус ребенка плюс» (варианты на 50 и 100 определений) ТУ 9398-001-64943561-2010 www.testgen.ru

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Заместитель министра Главный государственный санитарный врач О.В.Арнаутов 24 декабря 2010 г. Регистрационный 096-0710 МОЛЕКУЛЯРНЫЙ МЕТОД ОПРЕДЕЛЕНИЯ

Подробнее

ИНСТРУКЦИЯ СКАН ТЕРМИНАТОР NOS

ИНСТРУКЦИЯ СКАН ТЕРМИНАТОР NOS ИНСТРУКЦИЯ по применению набора реагентов для выявления ДНК терминатора NOS Agrobacterium tumefaciens методом полимеразной цепной реакции СКАН ТЕРМИНАТОР NOS ВНИМАНИЕ! Изучите инструкцию перед началом

Подробнее

ООО АЛЬФАЛАБ. Рабочая инструкция

ООО АЛЬФАЛАБ. Рабочая инструкция ООО АЛЬФАЛАБ Рабочая инструкция по применению набора реагентов для обнаружения ДНК возбудителей гельминтозов (Ascaris lumbricoides, Enterobius vermicularis, Opisthorchis felineus, Taenia solium, Diphyllobothrium

Подробнее

ИНСТРУКЦИЯ. ВНИМАНИЕ! Изучите инструкцию перед началом работы

ИНСТРУКЦИЯ. ВНИМАНИЕ! Изучите инструкцию перед началом работы ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гриппа А субтипа H5N1 («птичьего гриппа») (Influenza A virus subtype H5N1) методом полимеразной цепной реакции с обратной транскрипцией

Подробнее

RapidHIT мобильная система быстрого реагирования

RapidHIT мобильная система быстрого реагирования RapidHIT мобильная система быстрого реагирования Те же методы, тот же результат, но намного проще Выделение Амплификация Фрагментный анализ Достоинства, которые не оставят Вас равнодушными к RapidHIT 3

Подробнее

ИНСТРУКЦИЯ. по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции.

ИНСТРУКЦИЯ. по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции. ИНСТРУКЦИЯ по применению наборов реагентов для амплификации кднк вирусов, поражающих картофель, методом полимеразной цепной реакции. вирус скручивания листьев картофеля, вирус метельчатости верхушки картофеля,

Подробнее

3. Область применения. Методика предназначена для использования в научноисследовательских и диагностических учреждениях ветеринарного профиля.

3. Область применения. Методика предназначена для использования в научноисследовательских и диагностических учреждениях ветеринарного профиля. 1. Введение Вирус гриппа является возбудителем острых респираторных заболеваний у человека и животных. Он принадлежит к семейству Orthomyxoviridae. Существует три типа вируса гриппа: A, B, C. Вирус типов

Подробнее

ВИЧ, ДНК ВИЧ, РНК ВГС, ДНК ВГВ, ДНК ЦМВ, HLA B

ВИЧ, ДНК ВИЧ, РНК ВГС, ДНК ВГВ, ДНК ЦМВ, HLA B Приложение 4 к методическим рекомендациям по диспансерному наблюдению пациентов с установленным диагнозом «ВИЧ-инфекция» Правила оформления направления, взятия и доставки образцов крови для исследований

Подробнее

Номера по каталогу BC35T, BC35S, BC35M, BC35L

Номера по каталогу BC35T, BC35S, BC35M, BC35L КлинМаг ДНК Набор реактивов Номера по каталогу BC35T, BC35S, BC35M, BC35L Набор для очистки ДНК на магнитных частицах Инструкция по применению Набор реактивов КлинМаг ДНК предназначен только для исследовательских

Подробнее

Глава 11 Методы анализа генов

Глава 11 Методы анализа генов Глава 11 Методы анализа генов 1. CS Ферменты рестрикции: a) используются в ПЦР; b) узнают одноцепочечную ДНК; c) узнают и разрезают специфические двуцепочечные последовательности ДНК; d) встречаются у

Подробнее

АЛГОРИТМ ДИАГНОСТИКИ ВИРУСНОГО ГЕПАТИТА С В УСЛОВИЯХ МНОГОПРОФИЛЬНОЙ ЛАБОРАТОРИИ

АЛГОРИТМ ДИАГНОСТИКИ ВИРУСНОГО ГЕПАТИТА С В УСЛОВИЯХ МНОГОПРОФИЛЬНОЙ ЛАБОРАТОРИИ АЛГОРИТМ ДИАГНОСТИКИ ВИРУСНОГО ГЕПАТИТА С В УСЛОВИЯХ МНОГОПРОФИЛЬНОЙ ЛАБОРАТОРИИ О CMD CMD работает на рынке лабораторных услуг более 15 лет на базе Центрального НИИ Эпидемиологии российского разработчика

Подробнее

ИНСТРУКЦИЯ. «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм. по применению комплекта реагентов для экстракции ДНК из биологического материала

ИНСТРУКЦИЯ. «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм. по применению комплекта реагентов для экстракции ДНК из биологического материала ИНСТРУКЦИЯ по применению комплекта реагентов для экстракции ДНК из биологического материала «АмплиПрайм ДНК-сорб-АМ» АмплиПрайм ООО «НекстБио», Российская Федерация, 111394, город Москва, улица Полимерная,

Подробнее

Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин

Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин Комплексные решения для автоматизации и альтернативные решения для выделения ДНК и секвенирования от компании СкайДжин Болаева Кермен, к.б.н., специалист по молекулярной биологии 27 октября 2015 Производство

Подробнее

СОВРЕМЕННЫЕ ТЕХНОЛОГИИ РЕАЛИЗАЦИИ БИОХИМИЧЕСКИХ, ИММУНОХИМИЧЕСКИХ ИССЛЕДОВАНИЙ

СОВРЕМЕННЫЕ ТЕХНОЛОГИИ РЕАЛИЗАЦИИ БИОХИМИЧЕСКИХ, ИММУНОХИМИЧЕСКИХ ИССЛЕДОВАНИЙ СОВРЕМЕННЫЕ ТЕХНОЛОГИИ РЕАЛИЗАЦИИ БИОХИМИЧЕСКИХ, ИММУНОХИМИЧЕСКИХ ИССЛЕДОВАНИЙ г. Калининград 3-4 сентября 2014 ЛАБОРАТОРНАЯ ДИАГНОСТИКА ОБЛАСТЬ ПРИМЕНЕНИЯ Постановка диагноза Выбор метода лечения Профилактический

Подробнее

«Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы»

«Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы» Научно-образовательный форум «Лабораторная медицина России: современные технологии, внедрение новых тестов, организационные проблемы» Петров Олег Павлович Специалист отдела вакуумных систем г. Симферополь,

Подробнее

Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР. Гапонов А. М., Тутельян А. В. г. Москва

Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР. Гапонов А. М., Тутельян А. В. г. Москва Применение ультрафиолетового излучения сплошного спектра для деконтаминации продуктов ПЦР Гапонов А. М., Тутельян А. В. г. Москва Схема эксперимента В работе использовались диагностические наборы для PCR

Подробнее

ИНСТРУКЦИЯ ОТ-ГЕПАТОГЕН-С

ИНСТРУКЦИЯ ОТ-ГЕПАТОГЕН-С ИНСТРУКЦИЯ по применению набора реагентов для выявления РНК вируса гепатита С (HСV) методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) ОТ-ГЕПАТОГЕН-С Регистрационное удостоверение МЗ

Подробнее

Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014

Диагностика ВГЦ. Денис Годлевский Баку, Декабрь 2014 Диагностика ВГЦ Денис Годлевский Баку, Декабрь 2014 Виды диагностики Лабораторная Экспресс-диагностика Темы Антитела/ Неструктурные белки Полимеразная цепная реакция (ПЦР) Генотипирование Фибросканирование

Подробнее

ИНСТРУКЦИЯ. «РНК вируса гепатита С»

ИНСТРУКЦИЯ. «РНК вируса гепатита С» ИНСТРУКЦИЯ по применению панели контрольных образцов «РНК вируса гепатита С» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город Москва, улица Новогиреевская, дом 3а

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Заместитель министра здравоохранения Главный государственный санитарный врач Республики Беларусь О.В. Арнаутов 11 апреля 2011 г. Регистрационный

Подробнее

ИНСТРУКЦИЯ «РЕВЕРТАЗА»

ИНСТРУКЦИЯ «РЕВЕРТАЗА» ИНСТРУКЦИЯ по применению комплекта реагентов «РЕВЕРТАЗА» АмплиСенс ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Российская Федерация, 111123, город Москва, улица Новогиреевская, дом 3а Только для исследовательских

Подробнее

МЕТОДИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ИСПОЛЬЗОВАНИЮ ДИАГНОСТИЧЕСКИХ НАБОРОВ ДЛЯ ИДЕНТИФИКАЦИИ ДНК ПЛОДА В КРОВИ МАТЕРИ

МЕТОДИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ИСПОЛЬЗОВАНИЮ ДИАГНОСТИЧЕСКИХ НАБОРОВ ДЛЯ ИДЕНТИФИКАЦИИ ДНК ПЛОДА В КРОВИ МАТЕРИ «УТВЕРЖДАЮ» Директор ООО «Ген-технология» А.Н. Тороповский «24» августа 2011 г. МЕТОДИЧЕСКИЕ РЕКОМЕНДАЦИИ ПО ИСПОЛЬЗОВАНИЮ ДИАГНОСТИЧЕСКИХ НАБОРОВ ДЛЯ ИДЕНТИФИКАЦИИ ДНК ПЛОДА В КРОВИ МАТЕРИ Пособие для

Подробнее

ИЗМЕНЕНИЕ N 1 ГОСТ Р БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ.

ИЗМЕНЕНИЕ N 1 ГОСТ Р БИОЛОГИЧЕСКАЯ БЕЗОПАСНОСТЬ. Утверждено и введено в действие Приказом Федерального агентства по техническому регулированию и метрологии от 25 декабря 2008 г. N 731-ст Дата введения - 1 июля 2009 года ИЗМЕНЕНИЕ N 1 ГОСТ Р 52174-2003.

Подробнее

Программно-аппаратный комплекс для лабораторий молекулярной диагностики

Программно-аппаратный комплекс для лабораторий молекулярной диагностики Программно-аппаратный комплекс для лабораторий молекулярной диагностики XIRIL Neon 100 Rotor-Gene Q FRT-Manager АмплиСенс Комплексное предложение для Центров по профилактике и борьбе со СПИД и инфекционными

Подробнее

В экспериментальных работах надо сомневаться до тех пор, пока факты не заставляют отказаться от всяких сомнений.

В экспериментальных работах надо сомневаться до тех пор, пока факты не заставляют отказаться от всяких сомнений. «АЛИСА» лабораторная информационная система, которая является универсальной программой для автоматизации и оптимизации деятельности клиникодиагностической лаборатории и внутрилабораторного управления качеством.

Подробнее

Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ

Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ Короткова Т.Н. Заведующий КДЛ ГБУЗ ГКБ 64 ДЗМ Стационар на 830 коек Хирургия, гинекология травматология, кардиология, отделение рентгенхирургических методов диагностики и лечения, урология В год 3700

Подробнее

Оснащение современной лаборатории

Оснащение современной лаборатории Современное оборудование и расходные материалы для клинических лабораторных исследований мочи В.А. Крюкова ведущий эксперт отдела преаналитики и клинической биохимии ООО ОМБ Моча является вторым по значимости

Подробнее

ИНСТРУКЦИЯ. по применению реагента для транспортировки и хранения клинического материала. «Транспортная среда для мазков»

ИНСТРУКЦИЯ. по применению реагента для транспортировки и хранения клинического материала. «Транспортная среда для мазков» ИНСТРУКЦИЯ по применению реагента для транспортировки и хранения клинического материала «Транспортная среда для мазков» НАЗНАЧЕНИЕ Транспортная среда для мазков предназначена для транспортировки и хранения

Подробнее

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ

МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УТВЕРЖДАЮ Первый заместитель министра Д.Л. Пиневич 27.11.2015 Регистрационный 173-1115 АЛГОРИТМ ВЫДЕЛЕНИЯ И ВИДОВОЙ ИДЕНТИФИКАЦИИ НЕТУБЕРКУЛЕЗНЫХ МИКОБАКТЕРИЙ

Подробнее

ИНСТРУКЦИЯ. Регистрационные удостоверения: Influenza A virus, Influenza B virus (ГриппКомплекс) ФСР 2011/12014; Пан H1N1 ФСР 2010/07921

ИНСТРУКЦИЯ. Регистрационные удостоверения: Influenza A virus, Influenza B virus (ГриппКомплекс) ФСР 2011/12014; Пан H1N1 ФСР 2010/07921 ИНСТРУКЦИЯ по применению наборов реагентов для выявления РНК вирусов гриппа A Influenza A virus; гриппа B Influenza B virus; вирусов пандемического гриппа A(H1N1), подобных штамму A/California/4/2009 («свиной

Подробнее

Одновременная детекция РНК/ДНК ВИЧ-1 универсальный способ скрининга ВИЧ-инфекции. Петров В.В., ФБУН ЦНИИ Эпидемиологии Роспотребнадзора

Одновременная детекция РНК/ДНК ВИЧ-1 универсальный способ скрининга ВИЧ-инфекции. Петров В.В., ФБУН ЦНИИ Эпидемиологии Роспотребнадзора Одновременная детекция РНК/ДНК ВИЧ-1 универсальный способ скрининга ВИЧ-инфекции Петров В.В., ФБУН ЦНИИ Эпидемиологии Роспотребнадзора Актуальные вопросы ВИЧ-инфекции Санкт-Петербург, 2016 Маркеры ВИЧ-1

Подробнее